Reports

Tyrosine kinase receptor RON in human pancreatic cancer

Description
Tyrosine kinase receptor RON in human pancreatic cancer
Categories
Published
of 10
3
Categories
Published
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Transcript
  Tyrosine Kinase Receptor RON in HumanPancreatic Cancer Expression, Function, and Validation as a Target  E. Ramsay Camp,  MD 1 Anthony Yang,  MD 1 Mike J. Gray,  PhD 2 Fan Fan,  BS 2 Stanley R. Hamilton,  MD 3 Douglas B. Evans,  MD 1 Andrea T. Hooper,  BS 4 Daniel S. Pereira,  PhD 4 Daniel J. Hicklin,  PhD 4 Lee M. Ellis,  MD 1,2 1 Department of Surgical Oncology, University ofTexas M. D. Anderson Cancer Center, Houston,Texas. 2 Department of Cancer Biology, University ofTexas M. D. Anderson Cancer Center, Houston,Texas. 3 Department of Pathology, University of TexasM. D. Anderson Cancer Center, Houston, Texas. 4 ImClone Systems, Inc., New York, New York. BACKGROUND.  Specific tyrosine kinase receptors such as c-MET mediate epithe-lial-mesenchymal (EMT) transition, leading to phenotypic alterations associated with increased cell motility. It was hypothesized that RON, a tyrosine kinase re-ceptor related to c-MET, would be expressed in human pancreatic cancer cells,induce EMT, and would thus serve as a target for therapy in a preclinical model. METHODS.  RON expression in human pancreatic cancer specimens was assessedby immunohistochemistry. In pancreatic cancer cell lines, RON expression wasassessed by reverse-transcriptase polymerase chain reaction (PCR) and Westernblot analysis. The human pancreatic cancer cell line L3.6pl, with high RONexpression, was exposed to macrophage stimulating protein (MSP), the RONligand, and assessed for cell migration, invasion, and changes associated withEMT. Western blot analysis and immunofluorescent staining were used to assessalterations in protein expression and cellular location, respectively. A RON mono-clonal antibody (MoAb) was used to block ligand-induced activation of RON. RESULTS.  Immunohistochemical staining revealed RON overexpression in 93% of human pancreatic cancer specimens relative to nonmalignant ductal tissue. RONmRNA and protein was expressed in 9 of 9 human pancreatic cancer cell lines.Treatment of L3.6pl cells with MSP increased Erk phosphorylation, cell migration,and invasion ( P   <  .001). RON activation led to a decrease in membrane-boundE-cadherin in association with nuclear translocation of   b -catenin. RON MoAb inhib-ited downstream signaling as well as cell migration and invasion. In nude mice, RONMoAbinhibitedsubcutaneousandorthotopictumorgrowthbyabout60%. CONCLUSIONS.  RONactivation induced molecular and cellular alterations consistent with EMT. Inhibition of RON activation inhibited tumor growth in vivo. Novel anti-neoplastic therapies designed to inhibit RON activity may hinder mechanisms criti-cal for pancreatictumor progression.  Cancer  2007;109:1030–9.   2007AmericanCancerSociety. KEYWORDS: RON, macrophage stimulating protein, pancreatic cancer, tyrosinekinase receptor. D espite systemic therapy, few patients with locally advanced ormetastatic pancreatic cancer survive more than 2 years after di-agnosis. Insights into the molecular mechanisms that mediate tu-mor progression and metastasis of pancreatic cancer may lead tothe development of more effective antineoplastic therapies.The tyrosine kinase receptors mediate multiple processes involvedin tumor progression and metastasis, making them attractive targets fortherapy. One such receptor, RON, is a member of the MET proto-onco-gene family, 1 and its ligand, macrophage stimulating protein (MSP), issecreted by the liver. 2 RON activation mediates multiple signaling  Supported by National Institutes of Health grantsT32 CA 09599 (to E.R.C., A.Y., T.B.) and CA 16672 (Cancer Center Support Grant) and theLockton Fund for Pancreatic Cancer Research (toM.J.G., D.B.E., L.M.E.).Daniel J. Hicklin, Andrea T. Hooper, and Daniel S.Pereira are employees of Imclone Systems. Address for reprints: Lee M. Ellis, MD, Depart-ment of Surgical Oncology, Unit 444, Universityof Texas M. D. Anderson Cancer Center, P.O. Box301402, Houston, TX 77230-1402; Fax: (713)792-4689; E-mail: lellis@mdanderson.orgReceived October 4, 2006; revision receivedNovember 5, 2006; accepted November 30, 2006. ª 2007 American Cancer SocietyDOI 10.1002/cncr.22490Published online 20 February 2007 in Wiley InterScience (www.interscience.wiley.com). 1030  cascades involved in cell motility, adhesion, prolifera-tion, and survival, including the c-Src, ras/mitogen-acti-vated protein kinase (MAPK), phosphatidylinositol-3kinase/Akt,andfocaladhesionkinasepathways. 1,3–5 Epithelial-mesenchymal transition (EMT) is a pro-cess observed in embryonic development and tumori-genesis whereby cells lose epithelial characteristics andgain mesenchymal properties. 6 EMT is characterizedby loss of cellular adhesion and of normal cytoskeletalarrangements. 6 Epithelial cells undergoing EMT exhibitmesenchymal features correlating with increased mo-tility and invasion. 6 EMT has also been implicated intumor progression and metastasis formation and isassociated with a worse clinical prognosis. 7–9 In epithelial cells, activation of RON leads toincreased cell invasion and migration, properties asso-ciated with EMT. Although RON has been studied inbreast, colon, and ovarian cancers, where it has beenshown to be overexpressed, 10–12 there are no reportson the role of RON in pancreatic cancer. Determining the presence of RON and its function in pancreaticcancer may identify an important mediator of theaggressive behavior of pancreatic cancer and a poten-tial target for molecular therapy. We hypothesized thatthe activation of RON, similar to c-MET, leads to EMTand that blockade of RON’s activity with a monoclonalantibody (MoAb) inhibits tumor growth. MATERIALS AND METHODS Immunohistochemistry for RON Twenty-five formalin-fixed, paraffin-embedded pan-creatic cancer specimens, obtained from the archivesof the Department of Pathology at M. D. AndersonCancer Center, were sectioned 5–8  l m in thicknessand the sections were placed on poly-L-lysine-coatedslides, dewaxed in xylol, passed through a decreasing series of alcohol concentrations, and rehydrated indistilled water. The specimens were then incubated in1 3  Target Retrieval Solution (Dako, Carpinteria, CA)for 20 minutes after heating to 95–99 8 C in a vegetablesteamer. Endogenous peroxidase was blocked withperoxidase block from an EnVision þ  Rabbit Kit(Dako) for 5 minutes. After protein block for 1 hourthe specimens were incubated with the anti-RON-C20antibody for 1 hour at room temperature followed by labeled polymer from an EnVision þ  Rabbit Kit for 30minutes at room temperature. Specimens were devel-oped with diaminobenzidine and hydrogen peroxidefor 6 minutes and lightly stained with hematoxylin.Slides were analyzed by a single pathologist (S.R.H.)to confirm the presence of pancreatic adenocarci-noma and were graded based on the degree of pan-creatic intraepithelial neoplasia (PIN) present. 13 Cell Lines and Culture Conditions The human pancreatic cancer cell lines AsPC-1,BxPC-3, HPAF-2, MIAPACA2, Panc-1, HS7665, andCFPAC-1 were obtained from the American Type Cul-ture Collection (ATCC, Manassas, VA). The mousefibroblast cell line NIH3T3 and the human gastricfibroblast cell line Hs677.St were also obtained fromthe ATCC. The human pancreatic cancer cell linesFG and L3.6pl were kindly provided by I. J. Fidler,DVM, PhD (University of Texas M. D. Anderson Can-cer Center, Houston, TX). Cell lines were cultured inminimal essential medium (MEM) supplemented with 10% fetal bovine serum (FBS), penicillin-strep-tomycin, vitamins, sodium pyruvate, L-glutamine,and nonessential amino acids (Life Technologies,Grand Island, NY) at 37 8 C in 5% CO 2  and 95% air.Cells were confirmed to be free of   Mycoplasma . Reagents and Antibodies Recombinant human MSP was purchased from R&DSystems (Minneapolis, MN) and used at a concentra-tion of 100 ng/mL in all experiments. The RONMoAb 41A10 was supplied by ImClone Systems (New  York, NY). This antibody was validated by anenzyme-linked immunosorbent assay (ELISA) withrecombinant RON protein that demonstrated theantibody’s affinity for RON. 14 Similarly, the antibody  was shown not to crossreact with c-Met (data notshown). Antibodies utilized were as follows: polyclonalrabbit anti-RON-C20 (Santa Cruz Biotechnology,Santa Cruz, CA), polyclonal rabbit anti-phosphoryl-ated-p44/42 MAPK, polyclonal rabbit anti-p44/42MAPK, polyclonal rabbit anti-phosphorylated-Akt,polyclonal rabbit anti-Akt, polyclonal rabbit anti  b -catenin, polyclonal rabbit anti-phosphorylated-p38,polyclonal rabbit anti-p38 (all from Cell Signaling Technology, Beverly, MA), rabbit anti-actin (Sigma- Aldrich, St. Louis, MO), polyclonal mouse anti-E-cad-herin, polyclonal rabbit anti-N-cadherin (both fromZymed Laboratories, San Francisco, CA), polyclonalgoat anti-vimentin (Chemicon International, Teme-cula, CA), Alexa Fluor 488 goat antimouse, and Alexa Fluor 594 goat antirabbit (both from MolecularProbes, Eugene, OR). Reverse-Transcriptase Polymerase Chain Reaction andReal-Time Quantitative PCR mRNA was extracted from cells in 1 mL of Trizol rea-gent (Life Technologies) according to the manufac-turer’s protocol and subjected to reverse-transcriptasepolymerase chain reaction (PCR). For cDNA synthesis,3  l g of mRNA was mixed with 50 U of avian myelo-blastosis virus reverse transcriptase (Life Technolo- RON and Pancreatic Cancer/Camp et al. 1031  gies), 0.5 M Tris-HCl (pH 8.0), 0.5 M KCl, 0.05 MMgCl 2 , 2.5 mM dNTP, 40 U of RNase inhibitor (Boeh-ringer Mannheim, Indianapolis, IN), and 0.5  l g of random primer to achieve a final volume of 20  l L.The cDNA synthesis reaction was performed for1 hour at 37 8 C. A portion of this reaction mixture (5  l L)underwent PCR amplification in a reaction mix-ture (50  l L) that contained 1  l mol/L of each of 2 pri-mers (sense and antisense), 1.5 mmol/L of MgCl 2 ,0.2 mmol/L of each of 4 deoxynucleotides, and 2.5 U of Taq polymerase (Promega, Madison, WI). PCR amplifi-cation of RON was performed under the following conditions: 95 8 C for 5 minutes; 35 cycles of 30 sec-onds of denaturing at 95 8 C and 30 seconds of anneal-ing at 60 8 C; and 5 minutes of extension at 72 8 C. PCRproducts were analyzed by electrophoresis of 20  l L of each PCR reaction mixture in a 1.5% agarose gel, andbands were visualized by ethidium bromide staining.For negative controls, the fibroblast cell lines NIH3T3(murine) and Hs677.St (human) were used.Real-time quantitative PCR (qRT-PCR) was per-formed for Snail and Twist, known transcription fac-tors involved in EMT. 15–18 cDNA synthesis wasperformed in the same manner as for PCR. cDNAs werediluted in 200  l L of diethylpyrocarbonate water and 5 l L of each reaction mixture was used in each 25- l LqRT-PCR reaction. Amplifications were performed in a GeneAmp 7000 sequence detector (Applied Biosystems,Foster City, CA) using a 2-step cycling parameter (95 8 Cfor 5 minutes followed by 40 cycles of 95 8 C for 15 sec-onds and 60 8 C for 120 seconds). PCR products weredetected using SYBR Green I master mix (Applied Bio-systems). Snail and Twist gene expression were normal-ized using reference primers for GAPDH. All reactions were performed in triplicate and the comparative cyclethreshold methodology was used to determine relativechanges in gene expression. 19 For PCR, the following primers were used forRON: CATGGCATTTCATGGGCTGT and CAGACACT-CAGTCCCATTGA; and for MSP: AATACCACCACT-GCGGGCGT and TCAGTATCCACTGCTCCTTCA. ForqRT-PCR the primers used for Snail were: CTAACTA-CAGCGAGCTGCAG and CTGTCAGATGAGGACAGTGG;for Twist: GGAGTCCGCAGTCTTACGAG and TCTGG- AGGACCTGGTAGAGG; and for GAPDH: TCAAGGTCG-GAGTCAACGGATTTGGT and CATGTGG CCCATGAG-GTCCACCAC. Assessing Morphologic Changes After Exposure to MSP L3.6pl cells were grown in MEM with 10% FBS in a T25flask. When cells reached 40% confluence, cells wereplaced in MEM with 1% FBS overnight. Cells were thenexposed to MSP for 48 hours and digital images wereobtainedunderlightmicroscopyat 3 10magnification. Western Blot Analysis Cells were lysed in protein lysis buffer (20 mM so-dium phosphate [pH 7.4], 150 mM sodium chloride,1% Triton X-100, 5 mM EDTA, 5 mM phenylmethyl-sulfonyl fluoride, 1% aprotinin, 1  l g/mL leupeptin,and 500  l M Na  3  VO 4 ). Proteins were subjected toelectrophoresis on polyacrylamide gels and trans-ferred to nylon membranes (Millipore, Billerica, MA)as previously described. 20  After blocking with 5%milk in 0.1% Tween 20 in Tris-buffered saline, themembranes were probed with primary antibodies, washed, and treated with secondary antibodies la-beled with horseradish peroxidase. Protein bands were visualized with a commercially available che-moluminescence kit (Amersham Biosciences, Piscat-away, NJ). Immunofluorescent Staining Cells were grown on poly-L-lysine-coated glass cov-erslips in MEM with 10% FBS. At 40% confluencecells were placed in MEM with 1% FBS overnight.The following day cells were treated with MSP for 2,6, or 24 hours and then fixed with acetone. After fixa-tion cells were permeabilized by treatment withphosphate-buffered saline (PBS) containing 0.5% Triton X-100 and then blocked with 1% bovine serum albu-min. Cells were incubated with the primary antibody for actin, E-cadherin, or  b -catenin overnight at 4 8 C.The following day slides were washed, incubated with the corresponding Alexa Fluor secondary anti-body, and stained with Hoechst 33342 (MolecularProbes) as a nuclear label. After the final washes andmounting, cells were examined using a laser scan-ning Olympus microscope. Migration and Invasion Assays Cell migration in response to MSP was assessed utiliz-ing modified Boyden chambers according to the man-ufacturer’s protocol (Becton Dickinson Labware,Bedford, MA). Briefly, 10 5 L3.6pl cells were incubatedin MEM with 1% FBS on 8.0- l m pore size membraneinserts (Becton Dickinson Labware) in 24-well plates.Chemoattractants (MEM plus 1% FBS with or withoutMSP [100 ng/mL]) were placed in the bottom wells. Inexperiments using the RON MoAb the antibody wasplaced in the upper well 2 hours before the additionof MSP. At 6, 24, and 48 hours cells that had notmigrated were removed from the top side of theinserts with a cotton swab. Cells that had migrated tothe underside of the inserts were stained with Diff-Quik (Harleco, Gibbstown, NJ) and counted in 10separate fields at  3 100 magnification. A similar protocol was used to assess cell inva-sion in response to MSP except that the membrane 1032 CANCER March 15, 2007 / Volume 109 / Number 6  insert was coated with Matrigel and cells were trea-ted for 24, 48, and 72 hours. Animal Studies With RON MoAb Male athymic nude mice were obtained from theNational Cancer Institute Frederick Animal Produc-tion Area (Frederick, MD) and were acclimated for2 weeks. All animal studies were conducted underguidelines approved by the Animal Care and UseCommittee of the University of Texas M. D. AndersonCancer Center. Under sterile conditions, L3.6pl cells(10 6 ) in Hank balanced salt solution (HBSS) (0.1 mL) were injected subcutaneously into the right flank of each mouse. Four days after mice were injected, 10mice were randomly assigned to receive 1) PBS (con-trol) by twice weekly intraperitoneal (IP) injectionsor 2) 41A10 (1 mg/mouse) by twice weekly IP injec-tions. The mice were killed on Day 18, when tumorsin the control group exceeded 1.5 cm in longest di-ameter. Tumors were excised and weighed and tumorsections were placed in 10% buffered formalin forparaffin fixation or in optimal cutting temperaturecompound (Miles, Elkhart, IN) with freezing in liquidnitrogen for frozen tissue sections. The tumor vol-ume was calculated using the formula: tumor volu-me  ¼  ab 2 /2, in which  a  is the longest diameter and  b is the shortest diameter of the tumor.The results of our initial study using a subcuta-neous tumor model were validated with an orthoto-pic pancreatic cancer experiment. L3.6pl cells (5 3  10 5 cells) in HBSS (0.05 mL) were injected directly into the tail of the pancreas through a left flank inci-sion. 21 Treatment groups and protocols were similarto the experiment described above. Immunohistochemistry for Apoptotic Cells Terminal deoxynucleotidyl transferase-mediated nick end-labeling (TUNEL) was performed on paraffin-embedded tumor sections using a commercially available apoptosis detection kit (Promega). Sections were examined using a Zeiss photomicroscope (CarlZeiss, Thornwood, NY) equipped with a 3-chipcharge-coupled color camera (DXC-960 MD; Sony,Tokyo, Japan). The images were analyzed using Opti-mas image analysis software (v. 5.2; Bothell, WA). Statistical Analysis The differences between the means of the treatmentgroups were examined using InStat statistical soft- ware (GraphPad Software, San Diego, CA) using theMann-Whitney   U  -test. Statistical analysis was per-formed using InStat statistical software (v. 2.03;GraphPad Software). Data were tested for outliersusing the Grubb test (http://www.graphpad.com) forall experimental groups to avoid bias. Outliers werethen removed from the analysis.  P    .05 was consid-ered statistically significant. RESULTS RON Expressed in Human Pancreatic Cancer Specimens Immunohistochemical analysis revealed that 24(96%) of the 25 human pancreatic cancer specimensexpressed RON. All slides evaluated had both normalpancreatic ductal tissue and pancreatic carcinoma present. One specimen had no invasive carcinoma,but PIN was present. 13 The 1 tumor specimen thatdid not demonstrate RON staining had extensiveareas of necrosis that potentially compromised theintegrity of the tumor cells.RON was expressed in only 14 (56%) of 25 non-malignant pancreatic ductal tissue specimens. Thepancreatic cancer tissue overexpressed RON relativeto the matched nonmalignant pancreatic ductal tis-sue in 13 (93%) of the 14 cases in which RON wasexpressed in the nonmalignant tissue. Among the 11cases in which RON expression was not observed inthe normal tissue, RON was detected in the cancertissue in 10 cases. Overall, RON expression washigher in the pancreatic neoplastic epithelium thanin nonmalignant ducts in 23 cases (93%).The RON staining intensity subjectively increasedfrom normal tissue to PIN to invasive cancer (Fig. 1).The pattern of staining was heterogeneous, with bothcytoplasmic and membranous staining evident. Tentumors displayed both a membranous and cytoplas-mic staining pattern, whereas the remaining 13 hadonly cytoplasmic staining for RON. Although thelocation of staining was heterogeneous, a consistentapical vesicle-like distribution was demonstrated,possibly indicating a lysosomal location. In the 8specimens with PIN a similar vesicle-like pattern wasobserved. In general, the invasive cancer stainedmore intensely than the PIN, which stained moreintensely than the normal tissue. RON Expressed in Human Pancreatic Cancer Cell Lines Reverse-transcriptase PCR analysis revealed RONmRNA expression in all 9 pancreatic cancer celllines (Fig. 2A) (the MIAPACA2 cell line demon-strated only minimal RON mRNA expression). Wes-tern blot analysis confirmed the presence of RON inall 9 pancreatic cell lines (Fig. 2B). The highestexpression of RON was observed in L3.6pl cells.Conversely, Panc-1 cells had minimal RON expres-sion by Western blot analysis, similar to the findingsby PCR analysis. RON and Pancreatic Cancer/Camp et al. 1033  RON-Activated Downstream Signaling Mediators To assess the downstream signaling mediators acti-vated through RON, Western blot analysis was per-formed on L3.6pl cells exposed to MSP for varioustimes. MSP led to marked phosphorylation of Erk (Thr202/Tyr204), with peak activation at 60 minutes(Fig. 3A). MSP also increased Akt (Ser473) phospho-rylation after 60 minutes of MSP exposure. P38 phos-phorylation was not induced by MSP in L3.6pl cells(data not shown). Pretreatment of cells with RONMoAb inhibited MSP induction of Erk phosphoryla-tion in L3.6pl cells (Fig. 3B). RON-Induced Morphologic Changes Associated With EMT EMT is characterized by both a loss of cell-cell con-tact and a change in cell shape from a polarized cellto one that is more spindle-shaped. We assessed themorphologic changes in L3.6pl cells after MSP expo-sure for 48 hours. MSP led to altered cell morphol-ogy, with increased spindle-shaped cells representing loss of polarity, increased intercellular separation,and increased pseudopodia formation (Fig. 4). Thesemorphologic alterations were confirmed by immuno-fluorescent staining for actin. In contrast to thehighly organized actin filaments in the control cells,the cells treated with MSP demonstrate reorganiza-tion of the actin filaments with the presence of bothpseudopodia and the formation of stress fibers (Fig.4). Similar results were obtained in a second pancre-atic cancer cell line (FG) (data not shown). RON Activation Enhanced Pancreatic Cancer CellMigration and Invasion MSP led to an increase in migration of L3.6pl cells at alltimesevaluated (6, 24,and 48hours). A4-foldincreaseinmigration was demonstrated after 48hours ofMSPtreat-ment( P  < .001)(datanotshown).Similar to the findings with cell migration, MSP ledto an increase in invasion by L3.6pl cells at all timesevaluated (24, 48, and 72 hours). A greater than 4-fold FIGURE 1.  Representative samples of RON expression in human pancreatic cancers. Immunohistochemical analysis revealed that the malignant epitheliumoverexpressed RON relative to matched nonmalignant pancreatic ductal tissue in 93% of cases. RON expression was also noted in the premalignant PIN tissueand appeared to increase with the grade of PIN from IA to III. FIGURE 2.  Expression of RON in pancreatic cancer cell lines. (A) Reverse-transcriptase PCR demonstrated expression of RON mRNA in all pancreaticcancer cell lines. (B) Western blotting confirmed the expression of RON inthe pancreatic cancer cell lines. Vinculin was used as the loading control. 1034 CANCER March 15, 2007 / Volume 109 / Number 6
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x