How To, Education & Training

Regulation of freA, acoA, lysF, and cycA Expression by Iron Availability in Aspergillus nidulans

Description
Regulation of freA, acoA, lysF, and cycA Expression by Iron Availability in Aspergillus nidulans
Published
of 4
1
Published
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Transcript
   A  PPLIED AND  E NVIRONMENTAL   M ICROBIOLOGY , Nov. 2002, p. 5769–5772 Vol. 68, No. 110099-2240/02/$04.00  0 DOI: 10.1128/AEM.68.11.5769–5772.2002Copyright © 2002, American Society for Microbiology. All Rights Reserved. Regulation of   freA ,  acoA ,  lysF  , and  cycA  Expression byIron Availability in  Aspergillus nidulans Harald Oberegger, 1 Michelle Schoeser, 1 Ivo Zadra, 1 † Markus Schrettl, 1 Walther Parson, 2 and Hubertus Haas 1 *  Department of Molecular Biology 1  and Institute of Legal Medicine, 2 University of Innsbruck, A-6020 Innsbruck, Austria Received 3 June 2002/Accepted 2 August 2002 In the filamentous fungus  Aspergillus nidulans , iron homeostasis is regulated at the transcriptional level bythe negative-acting GATA factor SREA. In this study the expression of a putative heme-containing metal-loreductase-encoding gene,  freA , was found to be upregulated by iron limitation independently of SREA,demonstrating the existence of an iron-regulatory mechanism which does not involve SREA. In contrast to  freA , various other genes encoding proteins in need of iron-containing cofactors—  acoA ,  lysF  , and  cycA —weredownregulated in response to iron depletion. Remarkably, SREA deficiency led to increased expression of   acoA ,  lysF  , and  cycA  under iron-replete growth conditions. Virtually all organisms require iron for their growth. Theelectron transfer ability of the iron atom makes it essential forredox reactions ranging from respiration to ribonucleotide syn-thesis. Despite the fact that iron is the fourth most abundantelement in the earth’s crust, the amount of bioavailable iron is very limited since this metal is most commonly found as insol-uble Fe(III)-hydroxide. Thus, microorganisms need specializediron mobilization systems (14). On the other hand, an excess of iron in the cell can be detrimental, because iron can catalyzethe production of cell-damaging hydroxyl radicals in the pres-ence of oxygen. Therefore, the concentration of iron in bio-logical fluids is tightly regulated, and control is accomplishedprimarily by the rate of uptake.Under iron starvation, most fungi synthesize and excretelow-molecular-weight, Fe(III)-specific chelators, termed sid-erophores, in order to solubilize environmental iron. Subse-quently, cells recover the iron from the ferrisiderophore com-plexes via specific uptake mechanisms (17). Furthermore, mostfungi possess intracellular siderophores as an iron storagecompound. In this respect  Saccharomyces cerevisiae  is an ex-ception since it lacks the ability to synthesize siderophores,although it can utilize siderophores produced by other species.This yeast employs two distinct high-affinity iron uptake sys-tems which are both regulated by the paralogous transcrip-tional activators Aft1p and Aft2p (2, 32). The first mecha-nism—termed reductive iron assimilation—requires the actionof surface metalloreductases with different substrate specifici-ties (Fre1p to Fre4p) to reduce Fe(III) to Fe(II), which issubsequently transported into the cell by the permease-oxidasecomplex Ftr1p/Fet3p (1, 5, 27, 34). This system allows theuptake of both siderophore-bound and unbound iron (33). Thesecond iron uptake system—called nonreductive iron assimi-lation—is specialized for the uptake of siderophore-bound ironand depends on members of the major facilitator superfamily(16, 18, 33).In ascomycetes and basidiomycetes, siderophore biosynthe-sis and siderophore-mediated iron uptake are controlled byorthologous, negative-acting GATA transcription factors, e.g.,  Aspergillus nidulans  SREA,  Neurospora crassa  SRE, and  Usti- lago maydis  URBS1 (15, 29, 35). In  A .  nidulans , deletion of   sreA  results in derepressed intracellular and extracellular sid-erophore biosynthesis as well as increased accumulation of iron under sufficient iron supply due to derepressed sid-erophore uptake (21). Recently various members of the SREA regulon which are presumably involved in biosynthesis, trans-port, and utilization of siderophores have been identified, e.g.,  mirA , which encodes an orthologue of the  S .  cerevisiae  sid-erophore permeases (21, 22). Notably, neither the available  A .  nidulans  cDNA and genomic sequences nor the publicly acces-sible complete genomes of the close relatives  Aspergillus fu- migatus  (http://www.sanger.ac.uk/Projects/A_fumigatus/) and  N  .  crassa  (http://www-genome.wi.mit.edu/annotation/fungi /neurospora/) seem to contain orthologues of   S .  cerevisiae AFT1  or  AFT2 . Furthermore,  S .  cerevisiae  does not possess anorthologue of   A .  nidulans  SREA. Thus, the question remains if SREA represents the major iron regulator or if it is specific forcontrol of siderophore metabolism.Up to now, it was not known if   A .  nidulans  has the ability forreductive iron uptake. Searches for putative components of this system in various  A .  nidulans  sequence databases led to theidentification of expressed sequence tag clone o5f06a1, whosetranslation product displayed significant similarity to metal-loreductases. The sequence information was used to isolatecorresponding genomic clones from a cosmid library providedby the Fungal Genetic Stock Center (4). The five hybridizingclones, L4F02, L28H11, L25F03, L23A09, and L32A010, local-ized  freA  to chromosome IV, and the entire sequence of   freA  was sequenced directly from cosmid L23A09. Comparison of the genomic and cDNA sequences, obtained by 5  and 3  rapidamplification of cDNA ends according to the protocols of Frohman et al. (8), revealed an open reading frame of 1,797 bp * Corresponding author. Mailing address: Department of MolecularBiology, Fritz-Pregl-Str. 3/II, A-6020 Innsbruck, Austria. Phone: 43-512-507-3605. Fax: 43-512-507-2866. E-mail: hubertus.haas@uibk.ac.at.† Present address: Institute of Medical Chemistry and Biochemistry,University of Innsbruck, Innsbruck, Austria.5769  interrupted by  fi  ve introns, 53, 50, 43, 47, and 45 nucleotides(nt) in length (Fig. 1A). Additionally, two introns, 66 and 58 ntin length, are present in the 827-bp 5  untranslated region. The3   untranslated region was found to be 84 nt in length. Thededuced FREA protein has a calculated molecular mass of 67.2 kDa and shows signi fi cant similarity to various metal-loreductases, e.g., 24% identity (blastp E-value of 8e  32 ) to  S .  cerevisiae  Fre2p. An alignment of   A .  nidulans  FREA,  S .  cerevi- siae  Fre2p (10),  Arabidopsis thaliana  FRO2 (24), and thegp91 phox  subunit of the NADPH oxidase (25), which is criticalfor production of microbicidal oxidants in human neutrophils,is shown in Fig. 1B. FREA possesses all typical features of metalloreductases (7, 12): a  fl avin adenine dinucleotide cofac-tor binding site, an NADPH binding motif, and four typicallyspaced histidine residues predicted to coordinate a bis-hemestructure between transmembrane domains of the protein (Fig.1B).  S .  cerevisiae  possesses nine paralogous, metalloreductase-encoding genes which display different expression pro fi les:  FRE1  is upregulated by iron and copper depletion,  FRE2  to  FRE6  are upregulated by iron starvation only,  FRE7   is specif-ically upregulated by copper limitation, and YGL160w andYLR047c are regulated by neither copper nor iron availability(12, 19). Iron regulation of these genes is mediated by Aft1p,and copper regulation is mediated by Mac1p. Fre1p to Fre4pare involved in reduction of siderophore-bound and unboundiron (5, 34), Fre1p and Fre2p additionally function in copperuptake (11), and the function of Fre5p to Fre7p is unknown.To study the expression pattern of   freA ,  A .  nidulans  wild-typeand  sreA  deletion strains were grown for 24 h at 37 ° C understandard conditions, iron limitation, and copper starvation asdescribed previously (20). Northern blot analysis revealed thatthe  A .  nidulans freA  expression pattern resembles that of   Sac- charomyces FRE2  to  FRE4  by being iron but not copper reg-ulated (Fig. 2). These data indicate that  Aspergillus  FREA isinvolved in securing iron homeostasis. It might be a componentof a possible reductive iron assimilation system or function asan intracellular metalloreductase. In contrast to typical mem-bers of the SREA regulon, e.g.,  mirA , SREA de fi ciency did notlead to derepressed  freA  expression under iron-replete condi-tions. These data show that in  A .  nidulans  an iron-regulatorymechanism exists which does not involve SREA.Furthermore, SREA-independent expression of   freA  con- fi rms that SREA indeed acts as a direct repressor of extracel-lular siderophore biosynthesis and uptake. SREA de fi ciencyresults in 20-fold-increased accumulation of the intracellularsiderophore ferricrocin during iron-replete growth (21).Therefore, it could have been alternatively hypothesized thatSREA acts only as a repressor of ferricrocin biosynthesis andthat SREA de fi ciency causes iron deprivation via sequestrationof intracellular iron. But in this case, the expression of all ironstarvation-induced genes, including  freA , would be expected tobe upregulated under iron-replete conditions in an  sreA  dele-tion strain.Iron depletion can lead to upregulation of expression, as inthe case of genes involved in high-af  fi nity iron uptake. But theopposite regulatory pattern can also be found: expression of  FIG. 1.  A .  nidulans freA . (A) Intron-exon structure of   freA . (B) Alignment of   A .  nidulans  FREA,  S .  cerevisiae  Fre2p (P36033),  A .  thaliana  FRO2(CAA70770), and human gp91 phox  (NP_000388). Amino acid residues identical in three of the four proteins are in boldface, and amino acidresidues potentially involved in the bis-heme binding (H), NADPH binding (HPFT), and  fl avin adenine dinucleotide binding (GPYG) are shadedin gray.5770 OBEREGGER ET AL. A  PPL  . E NVIRON . M ICROBIOL  .   catB , encoding a heme-containing catalase, is downregulatedat the transcript level under iron starvation (21). To investigateif this regulatory pattern is speci fi c for  catB  or holds for otherproteins in need of iron-containing cofactors, the expression of the genes encoding the iron-sulfur cluster containing aconitase(  acoA ) and homoaconitase (  lysF  ), as well as the heme-contain-ing cytochrome  c  (  cycA ), was studied (23, 30). For partialanalysis of the putative  A .  nidulans  aconitase gene  acoC , theexpressed sequence tag clone c8d09 was sequenced. It containsthe C-terminal 398 amino acids of ACOC displaying 88 and73% identity to the aconitases of   Aspergillus terreus  and  S .  cerevisiae , respectively. Northern blot analysis proved that ex-pression of genes involved in pathways as distinct as the citricacid cycle (  acoA ) and respiration (  cycA ), as well as lysine andpenicillin biosynthesis (  lysF  ), is downregulated between two-and eightfold under iron limitation in the wild-type and theSREA-de fi cient strains (Fig. 2). With an eightfold-decreasedtranscript level,  cycA  was the gene most dramatically affectedby iron depletion. Notably, CYCA-de fi cient  A .  nidulans  mu-tants are viable, and it was suggested previously that this is dueto the ability of   Aspergillus  to ferment and to use alternativerespiratory pathways (3). Taken together, these data suggestthat, during iron depletion, decreased expression of   cycA  savesenergy and iron for other processes essential for survival underiron limitation. Assuming that FREA is involved in iron ho-meostasis, as has been shown previously for four of the six iron-regulated  S .  cerevisiae  paralogues (5, 10, 34), the oppositeregulation of   freA  versus  acoA ,  lysF  , and  cycA  by iron availabil-ity suggests that under iron depletion the  fl ow of this limitingmetal might be directed from various metabolic pathways tosystems needed to secure iron homeostasis.Interestingly, the transcript levels of   acoA ,  lysF  , and  cycA  were elevated between two- (  acoA ) and ninefold (  cycA ) underiron-replete conditions in the  sreA  deletion strain (Fig. 2).Therefore, expression of these genes might be subject toSREA regulation. Alternatively, upregulation of these genesmight be caused indirectly since SREA de fi ciency leads toincreased iron accumulation and increased oxidative stress(21): (i) it may re fl ect the increased bioavailability of iron within SREA-de fi cient cells, or (ii) it may represent an oxida-tive stress response. In the latter case, the increased expressionof these genes could represent a compensatory response in- voked to maintain cellular enzyme activities because, e.g., iron-sulfur cluster-containing enzymes are particularly sensitive toinactivation by oxidative attack (9). In this respect it is note- worthy that, in  Escherichia coli , expression of aconitase-encod-ing  acnA  is speci fi cally induced by iron and oxidative stress(13), and it was suggested previously that the aconitase pro-teins serve as a protective buffer against oxidative stress byacting as a sink for reactive oxygen species (28). The upregu-lation of   cycA  expression might also be a response to oxidativestress because cytochrome  c  plays an important role in theantioxidant system of mitochondria (26). Remarkably, the pro-moter region of   lysF   contains several GATA motifs whichpotentially represent SREA binding sites. But since mutationalanalysis showed that at least two of these GATA sites mediatea positive effect on  lysF   expression, a direct involvement of therepressor SREA seems to be doubtful (31). Hybridization probes.  The hybridization probes used in thisstudy were generated by PCR with oligonucleotides 5  -AGCCCGGTGTGAAAAGAG and 5  -AACAGGAGGAGGATTGCGCC for  mirA , 5  -AGATCATGGGAGTTGACCTG and 5  - AGACGGATTGTATGGCGATGAG for  freA , 5  -ACCCTTTCTCTCTACCTC and 5  -CGCGATTAGACGAGATAA for  cycA , 5  -TATCCATGTAGTCCGCCC and 5  -GGTCCCACTGTCCAATGC for  acoA , 5  -GCTGACGAACGAAGAAGand 5  -GCGTTCTTAACCCATTTC for  lysF  , and 5  -CGGTG ATGAGGCACAGT and 5  -CGGACGTCGACATCACA for  -actin-encoding  acnA . Nucleotide sequence accession number.  The  freA  and  acnA sequences were assigned GenBank accession no. AF515629and AF515630, respectively. We are grateful to Bruce A. Roe et al. for the information suppliedby the  A .  nidulans  cDNA sequencing project and to the WhiteheadInstitute/MIT Center for Genome Research for access to the  N  .  crassa genome sequence, as well as to the Sanger Institute and its collabora-tors David Denning and Andrew Brass at the University of Manchesterfor access to the  A .  fumigatus  genome sequence. We thank Axel Bra-khage for a plasmid containing a  lysF   fragment.This project was supported by Austrian Science Foundation grantFWF-P13202-MOB (to H.H.). REFERENCES 1.  Askwith, C. C., D. de Silva, and J. Kaplan.  1994. Molecular biology of ironacquisition in  Saccharomyces cerevisiae . Mol. Microbiol.  20: 27 – 34.2.  Blaiseau, P. L., E. Lesuisse, and J. M. Camadro.  2001. Aft2p, a novel FIG. 2. Expression of   freA ,  mirA ,  cycA ,  acoA , and  lysF   under stan-dard (  Fe), iron depletion (  Fe), and copper depletion (  Cu) con-ditions in  A .  nidulans  wild-type (  wt ) and SREA-de fi cient (   sreA )strains. Fungal strains were grown for 24 h in minimal medium con-taining 10   m FeSO 4  and 10   m CuSO 4  as described previously (20);for iron- and copper-depleted growth the addition of the respectivemetal was omitted. As a control for loading and RNA quality, blots were hybridized with the   -actin-encoding  acnA  gene (6). (A and B)Northern blot analysis was performed with 1  g of mRNA (A) or 10  gof total RNA (B), respectively. (C) Quanti fi cation of mRNA levelsnormalized to  acnA  levels with a PhosphorImager. Bars representmean values of two independent experiments; standard deviations didnot exceed 20%.V OL  . 68, 2002 IRON REGULATION IN  ASPERGILLUS NIDULANS  5771  iron-regulated transcription activator that modulates, with Aft1p, intracellu-lar iron use and resistance to oxidative stress in yeast. J. Biol. Chem.  276: 34221 – 34226.3.  Bradshaw, R. E., D. M. Bird, S. Brown, R. E. Gardiner, and P. Hirst.  2001.Cytochrome  c  is not essential for viability of the fungus  Aspergillus nidulans .Mol. Genet. Genomics  266: 48 – 55.4.  Brody, H., J. Grif  fi th, A. J. Cuticchia, J. Arnold, and W. E. Timberlake.  1991.Chromosome-speci fi c recombinant DNA libraries from the fungus  Aspergil- lus nidulans . Nucleic Acids Res.  19: 3105 – 3109.5.  Dancis, A., D. G. Roman, G. J. Anderson, A. G. Hinnebusch, and R. D.Klausner.  1992. Ferric reductase of   Saccharomyces cerevisiae : molecularcharacterization, role in iron uptake, and transcriptional control by iron.Proc. Natl. Acad. Sci. USA   89: 3869 – 3873.6.  Fidel, S., J. H. Doonan, and N. R. Morris.  1988.  Aspergillus nidulans  containsa single actin gene which has unique intron locations and encodes a gamma-actin. Gene  70: 283 – 293.7.  Finegold, A. A., K. P. Shatwell, A. W. Segal, R. D. Klausner, and A. Dancis. 1996. Intramembrane bis-heme motif for transmembrane electron transportconserved in a yeast iron reductase and the human NADPH oxidase. J. Biol.Chem.  271: 31021 – 31024.8.  Frohman, M. A., M. K. Dush, and G. R. Martin.  1988. Rapid production of full-length cDNAs from rare transcripts: ampli fi cation using a single gene-speci fi c oligonucleotide primer. Proc. Natl. Acad. Sci. USA   85: 8998 – 9002.9.  Gardner, P. R., and I. Fridovich.  1992. Inactivation-reactivation of aconitasein  Escherichia coli . A sensitive measure of superoxide radical. J. Biol. Chem. 267: 8757 – 8763.10.  Georgatsou, E., and D. Alexandraki.  1994. Two distinctly regulated genes arerequired for ferric reduction, the  fi rst step of iron uptake in  Saccharomyces cerevisiae . Mol. Cell. Biol.  14: 3065 – 3073.11.  Georgatsou, E., L. A. Mavrogiannis, G. S. Fragiadakis, and D. Alexandraki. 1997. The yeast Fre1p/Fre2p cupric reductases facilitate copper uptake andare regulated by the copper-modulated Mac1p activator. J. Biol. Chem. 272: 13786 – 13792.12.  Georgatsou, E., and D. Alexandraki.  1999. Regulated expression of the Saccharomyces cerevisiae  Fre1p/Fre2p Fe/Cu reductase related genes. Yeast 15: 573 – 584.13.  Gruer, M. J., and J. R. Guest.  1994. Two genetically-distinct and differen-tially-regulated aconitases (AcnA and AcnB) in  Escherichia coli . Microbiol-ogy  140: 2531 – 2541.14.  Guerinot, M. L.  1994. Microbial iron transport. Annu. Rev. Microbiol.  48: 743 – 772.15.  Haas, H., I. Zadra, G. Sto ¨ f  fl er, and K. Angermayr.  1999. The  Aspergillus nidulans  GATA factor SREA is involved in regulation of siderophore bio-synthesis and control of iron uptake. J. Biol. Chem.  274: 4613 – 4619.16.  Heymann, P., J. F. Ernst, and G. Winkelmann.  2000. Identi fi cation andsubstrate speci fi city of a ferrichrome-type siderophore transporter (Arn1p)in  Saccharomyces cerevisiae . FEMS Microbiol. Lett.  186: 221 – 227.17.  Leong, S. A., and G. Winkelmann.  1998. Molecular biology of iron transportin fungi. Met. Ions Biol. Syst.  35: 147 – 186.18.  Lesuisse, E., M. Simon-Casteras, and P. Labbe.  1998. Siderophore-mediatediron uptake in  Saccharomyces cerevisiae : the SIT1 gene encodes a ferriox-amine B permease that belongs to the major facilitator superfamily. Micro-biology  144: 3455 – 3462.19.  Martins, L. J., L. T. Jensen, J. R. Simon, G. L. Keller, D. R. Winge, and J. R.Simons.  1998. Metalloregulation of FRE1 and FRE2 homologs in  Saccha- romyces cerevisiae . J. Biol. Chem.  273: 23716 – 23721.20.  Oberegger, H., I. Zadra, M. Schoeser, and H. Haas.  2000. Iron starvationleads to increased expression of Cu/Zn-superoxide dismutase in  Aspergillus .FEBS Lett.  485: 113 – 116.21.  Oberegger, H., M. Schoeser, I. Zadra, B. Abt, and H. Haas.  2001. SREA isinvolved in regulation of siderophore biosynthesis, utilization and uptake in  Aspergillus nidulans . Mol. Microbiol.  41: 1077 – 1089.22.  Oberegger, H., I. Zadra, M. Schoeser, B. Abt, W. Parson, and H. Haas.  2002.Identi fi cation of members of the  Aspergillus nidulans  SREA regulon: genesinvolved in siderophore biosynthesis and utilization. Biochem. Soc. Trans. 30: 781 – 783.23.  Raitt, D. C., R. E. Bradshaw, and T. M. Pillar.  1994. Cloning and charac-terisation of the cytochrome C gene of   Aspergillus nidulans . Mol. Gen.Genet.  242: 17 – 22.24.  Robinson, N. J., C. M. Procter, E. L. Connolly, and M. L. Guerinot.  1999. A ferric-chelate reductase for iron uptake from soils. Nature  397: 694 – 697.25.  Royer-Pokora, B., L. M. Kunkel, A. P. Monaco, S. C. Goff, P. E. Newburger,R. L. Baehner, F. S. Cole, J. T. Curnutte, and S. H. Orkin.  1986. Cloning thegene for an inherited human disorder — chronic granulomatous disease — onthe basis of its chromosomal location. Nature  322: 32 – 38.26.  Skulachev, V. P.  1998. Cytochrome  c  in the apoptotic and antioxidant cas-cades. FEBS Lett.  423: 275 – 280.27.  Stearman, R., D. S. Yuan, Y. Yamaguchi-Iwai, R. D. Klausner, and A.Dancis.  1996. A permease-oxidase complex involved in high-af  fi nity ironuptake in yeast. Science  271: 1552 – 1557.28.  Tang, Y., M. A. Quail, P. J. Artymiuk, J. R. Guest, and J. Green.  2002.  Escherichia coli  aconitases and oxidative stress: post-transcriptional regula-tion of   sodA  expression. Microbiology  148: 1027 – 1037.29.  Voisard, C., J. Wang, J. L. McEvoy, P. Xu, and S. A. Leong.  1993.  urbs1 , agene regulating siderophore biosynthesis in  Ustilago maydis , encodes a pro-tein similar to the erythroid transcription factor GATA-1. Mol. Cell. Biol. 13: 7091 – 7100.30.  Weidner, G., B. Steffan, and A. A. Brakhage.  1997. The  Aspergillus nidulans lysF   gene encodes homoaconitase, an enzyme involved in the fungus-speci fi clysine biosynthesis pathway. Mol. Gen. Genet.  255: 237 – 247.31.  Weidner, G., S. Steidl, and A. A. Brakhage.  2001. The  Aspergillus nidulans homoaconitase gene  lysF   is negatively regulated by the multimeric CCAAT-binding complex AnCF and positively regulated by GATA sites. Arch. Mi-crobiol.  175: 122 – 132.32.  Yamaguchi-Iwai, Y., A. Dancis, and R. D. Klausner.  1995. AFT1: a mediatorof iron regulated transcriptional control in  Saccharomyces cerevisiae . EMBOJ.  14: 1231 – 1239.33.  Yun, C. W., T. Ferea, J. Rashford, O. Ardon, P. O. Brown, D. Botstein, J.Kaplan, and C. C. Philpott.  2000. Desferrioxamine-mediated iron uptake in Saccharomyces cerevisiae . Evidence for two pathways of iron uptake. J. Biol.Chem.  275: 10709 – 10715.34.  Yun, C. W., M. Bauler, R. E. Moore, P. E. Klebba, and C. C. Philpott.  2001.The role of the FRE family of plasma membrane reductases in the uptake of siderophore-iron in  Saccharomyces cerevisiae . J. Biol. Chem.  276: 10218 – 10223.35.  Zhou, L. W., H. Haas, and G. A. Marzluf.  1998. Isolation and characteriza-tion of a new gene,  sre , which encodes a GATA-type regulatory protein thatcontrols iron transport in  Neurospora crassa . Mol. Gen. Genet.  259: 532 – 540. 5772 OBEREGGER ET AL. A  PPL  . E NVIRON . M ICROBIOL  .
Search
Similar documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x