Reviews

Polymerase Chain Reaction

Description
JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 1991, p /91/ $02.00/0 Copyright , American Society for Microbiology Vol. 29, No. 8 Distinction of Deep versus Superficial Clinical
Categories
Published
of 7
0
Categories
Published
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Transcript
JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 1991, p /91/ $02.00/0 Copyright , American Society for Microbiology Vol. 29, No. 8 Distinction of Deep versus Superficial Clinical and Nonclinical Isolates of Trichosporon beigelii by Isoenzymes and Restriction Fragment Length Polymorphisms of rdna Generated by Polymerase Chain Reaction BRYAN J. KEMKER,l PAUL F. LEHMANN,`* JAMES W. LEE,2 AND THOMAS J. WALSH2 Department of Microbiology, Medical College of Ohio, P.O. Box 10008, Toledo, Ohio ,1 and Section of Infectious Diseases, National Cancer Institute, Bethesda, Maryland Received 13 December 1990/Accepted 23 May 1991 Fifteen clinical and environmental strains of Trichosporon beigelii were analyzed for similarities by using morphological features, biochemical profiles based on carbon compound assimilation and uric acid utilization, isoenzyme electrophoresis, and restriction fragment length polymorphisms of a segment of genes coding for rrna expanded with the polymerase chain reaction. The findings suggest that strains that cause invasive disease are distinct from the superficial and the nonclinical isolates and that isolates from the skin and mucosae represent a number of different organisms, including some environmental forms. The study shows that T. beigelii is a complex of genetically distinct organisms and that more than one type is found in clinical samples. Trichosporon beigelii (Kuchenmeister et Rabenhorst) Vuillemin is an emerging pathogen in immunocompromised patients. Although long known as the cause of white piedra in immunologically normal hosts, increasingly this basidiomycetous, arthroconidial yeast is being reported as an opportunistic pathogen causing deep-seated and disseminated infections in immunocompromised patients (9, 24-26). Current taxonomical treatment in The Yeasts (12) places T. beigelii in synonymity with T. cutaneum (De Beurmann, Gougerot et Vaucher) Ota; however, this taxon contains organisms that differ from each other in a number of morphological, physiological, and genetic characteristics (6, 7, 13, 29). Lee et al. demonstrated that deeply invasive isolates of T. beigelii were distinguishable from superficial and environmental isolates by colonial and microscopic morphology (13). Homology studies, using DNA-DNA reassociation, of the type strain of T. cutaneum and some of the strains that have been placed in synonymity with T. cutaneum in The Yeasts have shown that T. cutaneum is unrelated to T. cutaneum var. antarcticum, T. infestans, T. loubieri, T. lutetiae, Geotrichum vanriji, and T. dulcitum (7). There has been a report that T. beigelii has a variable ubiquinone type (29), and Gudho, Kurtzman, and Peterson communicated the unpublished results of Billon-Grand that the ubiquinone type of a strain of T. beigelii from white piedra in a monkey differed from that of the type strain of T. cutaneum (6). The 18S and 25S RNA sequences support the placing of these two strains into distinct, though clearly related species (6). However, there appears to have been no detailed study on the genetic relationships of clinical isolates from humans. That invasive clinical isolates of T. beigelii (previously known as T. cutaneum) may be genetically distinct from superficial clinical isolates has been suggested earlier (5). Here we report on a series of different clinical isolates, including ones causing deep-seated infections that were * Corresponding author. Electronic mail address: 1677 isolated from blood and ones obtained from mucosal and cutaneous sites. Also studied are some nonclinical or environmental strains. The characteristics of the organisms have been compared for morphological features, carbon substrate assimilation profiles, utilization of uric acid, isoenzyme profiles, and restriction fragment length polymorphisms (RFLPs) in a segment of the gene coding for rrna (rdna) which had been expanded with the polymerase chain reaction. The rdna, studied herein, was composed largely of the two internally transcribed spacer (ITS) regions and the 5.8S rdna that lie between the nuclear small rdna and nuclear large rdna sequences in the genome (Fig. 1). This area was chosen because ITS regions appear to undergo more rapid evolutionary change than is found for the associated rdna sequences and may show heterogeneity when strains of closely related species are compared (28). In contrast, the nuclear small, nuclear large, and 5.8S rdna sequences appear to evolve more slowly and have been useful in placing organisms into different groups on the basis of their phylogeny (23). MATERIALS AND METHODS Fungi. Fifteen isolates were obtained for study as listed in Table 1. Ten of these were derived from clinical sources, and five were from the American Type Culture Collection, Rockville, Md. One isolate, TSAS-87, showed four different stable morphotypes, and these were analyzed separately. Isolates were stored on potato dextrose agar (Remel, Lenexa, Kans.) slants at -70 C and then were subcultured to Sabouraud glucose agar (D-glucose, 20 g; neopeptone [catalog 0119; Difco, Detroit, Mich.], 10 g; agar, 15 g/liter of water). The morphological features of these strains have been studied in detail (13) and are listed in Table 1. All strains were tested by the diazonium blue B test (27) by using freshly made reagent that was applied to 3-week-old colonies that had been grown on a modified Sabouraud agar (neopeptone, 1 g; D-glucose, 4 g; yeast extract [catalog 0127; Difco], 0.5 g; agar, 1.5 g/100 ml). 1678 KEMKER ET AL. J. CLIN. MICROBIOL. Nuclear small rdna ITS 5.8S rdna ITS Nuclear large rdna ITS5 ITS4 FIG. 1. Map of DNA sequence amplified in the polymerase chain reaction. ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TC CTCCGCTTATTGATATGC) are oligomer primers that bind to conserved sequences on opposite DNA strands just within an end of the nuclear small and nuclear large rdna genes (28). The amplified DNA is composed primarily of two ITS regions and the 5.8S rdna. Physiological studies. All cultures were incubated at 30 C. For carbon compound assimilation profiles, the API 20C kit (Analytab, Plainview, N.Y.) was employed. This tested the abilities of the strains to produce visible growth after 3 days in an agar medium containing one of a panel of different compounds as the sole source of carbon. Details of the compounds are given in Table 1 with the results. Utilization of uric acid was determined after the fungi were inoculated as a streak on medium containing a suspension of uric acid (19), buffered at ph 5.0 using 20 g of KH2PO4 per liter (18). The production of a clear zone in the agar after 14 days of growth was considered indicative of uric acid utilization. Isoenzyme preparation. Multiple colonies of 3-day-old growth on Sabouraud glucose agar were used to inoculate 50 TABLE 1. Morphology and physiological features of T. beigelii Strain Site Source Morphology ml of YNB-mannitol-sucrose broth (yeast-nitrogen base without amino acids, 0.03 M sucrose, 0.1 M mannitol) in 250-ml Erlenmeyer flasks (15). The flasks were incubated (66 h, 27 C, 250 rpm on a gyratory shaker), and then the fungus was harvested and proteins were extracted for isoenzyme analysis as described previously (14). Briefly, the cells were washed in 100 mm Tris-hydrochloride buffer, ph 8.0, and then broken by vortexing with 0.45-mm-diameter glass beads. The homogenate was centrifuged (13,000 x g, 5 min), and then the supernatant was assayed for protein content by using the Bradford method (3). The extract was then applied, with 250 p.g of protein per lane, to native discontinuous polyacrylamide gels (either 5.0 or 7.5% [wt/vol] acrylamide content, as shown in Table 2) and subjected to electrophoresis (16 h, 5 V/cm). Following electrophoresis, the gels were removed and washed (15 to 30 min, 60 rpm) twice in 100 ml of buffer appropriate for detecting enzyme activity. Enzyme activity was detected by using reagents and buffers listed in Table 2, and bands of enzyme activity were recorded by photography. Cluster analysis. As in a previous study (15), the unweighted pair mean group average clustering and centroid clustering algorithms were used. DNA extraction. The miniprep method, based on that described for Candida albicans (22), was used. A small inoculum was placed into 50 ml of YNB-mannitol-sucrose broth in 250-ml Erlenmeyer flasks. After incubation for 66 h at 27 C in a 250-rpm gyratory shaker, 10 ml of cells were transferred to a 15-ml polypropylene centrifuge tube and Utilization' Uri Gly Ino Sor Tre Mlz Raf Clinicald Deep seated TSAS-87P Blood UT Powdery TSAS-87R Blood UT Rugose TSAS-87PG Blood UT Powdery-grey TSAS-87RG Blood UT Rugose-grey TCM-86 Blood NCI Powdery-grey Blood NYSDH Powdery Blood NYSDH Powdery/powdery-grey UMSMT-1 Blood UMSMT Powdery UMSMT-2 Blood UMSMT Rugose UMSMT-3 Blood UMSMT Rugose Mucosa associated Stool NYSDH Powdery/powdery-grey Sputum NYSDH Powdery - - Superficial Toenail Skin (leg) NYSDH ATCC Creamy Creamy Nonclinicald Soil ATCC Grey Fat synthesis ATCC Grey Patent strain ATCC Grey Water ATCC Grey a UT, University of Texas Health Science Center at San Antonio; NCI, National Cancer Institute, Bethesda, Md.; NYSDH, New York State Department of Health, Albany; UMSMT, University of Maryland School of Medical Technology, Baltimore; ATCC, American Type Culture Collection, Rockville, Md. b Colony morphologies are described in detail elsewhere (13). 'Uri, uric acid; Gly, glycerol; Ino, inositol; Sor, sorbitol (glucitol); Tre, trehalose; Mlz, melezitose; Raf, raffinose. All stains utilized D-glucose, 2-keto-D-gluconate, L-arabinose, D-xylose, D-galactose, a-methyl-d-glucoside, N-acetyl-D-glucosamine, cellobiose, lactose, maltose, and sucrose. No strain utilized ribitol or xylitol. Utilization of all compounds except uric acid was determined with the API 20C kit. d All strains were positive in the diazonium blue B test. VOL. 29, 1991 T. BEIGELII GENETIC HETEROGENEITY 1679 TABLE 2. Enzyme stains Enzyme Buffer Substrate' Visualization cs-glucosidase (7.5) 0.1 M Na acetate, ph Methylumbelliferyl (x-d- Fluorescent bands (10 min, glucoside, 3 mg 250C),-Glucosidase (7.5) 0.1 M Na acetate, ph Methylumbelliferyl r-d- Fluorescent bands (30 min. glucoside. 3 mg 250C) Esterase (7.5) 0.1 M Na phosphate. ph Methylumbelliferyl acetate, Fluorescent bands (15 min, 20 mg 250C) Esterase (7.5) 0.1 M Na phosphate. ph 7.0 a-naphthyl acetate, 20 mg; Brown bands (120 minm 370C) Fast Blue RR salt, 40 mg Glucose-6-phosphate 0.1 M Tris-hydrochloride, D-Glucose-6-phosphate, 30 Purple bands (5 min, 370C) dehydrogenase (7.5) ph 8.0 mg; NADP, 10 mg; PMS MTT buffer' Malate dehydrogenase (7.5) 0.1 M Tris-hydrochloride. L(-)-Malic acid, 300 mg; Purple bands (45 min, 370C) ph 8.0 NAD, 10 mg; PMS MTTbuffer' Superoxide dismutase (7.5) Water Nitroblue tetrazolium. then Clear bands riboflavin TEMED' Catalase (5) Water Hydrogen peroxide, then Clear bands (15 min, 25 C) FeCI3 K3Fe(CN),i Preparation of most substrates and buffers was based on formulae described by Harris and Hopkinson (8). The amount of protein loaded was 250 xlg per lane, and the percent concentration of polyacrylamide in the separating gel (g/100 ml) is listed in parentheses. Chemicals, except inorganic salts, were obtained from Sigma Chemical Co., St. Louis. Mo. Amounts are given for 100 ml of staining solution except for detection of dehydrogenases. Typical times are given. The gel was placed on a UV light box having a midrange filter and photographed through a dark-green filter (no. 58; Tiffen, Hauppauge, N.Y.) with Polaroid 667 film (Polaroid, Cambridge, Mass.). PMS, phenazine methosulfate. 5 mg; MTT, 3-(4.5-dimethylthiazol-2-yl)-2.5-diphenyltetrazolium bromide. 5 mg; buffer, 0.1 M Tris-hydrochloride, ph ml. TEMED, N,N,N', N'-tetramethylethylenediamine. Method of Beauchamp and Fridovich (2). Clear bands developed after exposing gel to light. Hydrogen peroxide was prepared by adding 10.ld of a 30% solution into 100 ml of water. After washing, the gel was developed by using a mixture prepared from equal parts of aqueous solutions of ferric chloride (2 g/100 ml) and potassium ferricyanide (2 g/100 ml). centrifuged (5 min, 1,500 x g). The pellet was resuspended in 1.0 ml of a 1.0 M sorbitol solution, and spheroplasts were prepared by adding both 100 p.l of a 300-,ug/ml solution of Zymolyase 20T (20,000 U/g; Miles Laboratories, Elkhart, Ind.) in 1.0 M sorbitol and 100 p.l of 2-mercaptoethanol (Eastman Kodak, Rochester, N.Y.). After gentle mixing, the tubes were incubated on a reciprocal shaker (60 min, 37 C, 75 rpm). The tubes were then centrifuged (1,500 x g), and the supernatant was removed. The cells were resuspended in 500.1I of TE buffer (10 mm Tris-hydrochloride, ph 8.0, containing 1 mm sodium EDTA); 100 p.1 of aqueous sodium dodecyl sulfate (SDS) solution (10 g/100 ml) was then added to each tube. After mixing, by inverting the tubes several times, the tubes were incubated (30 min, 65 C). The suspension was transferred to 1.5-ml microcentrifuge tubes, and the DNA was extracted twice with an equal volume of phenolchloroform; this was followed by an extraction with chloroform-isoamyl alcohol (21). The DNA was precipitated following the addition of 2.5 volumes of absolute alcohol and 10 Rl of 5.0 M NaCl and the placing of tubes at -20 C overnight. After centrifugation (13,000 x g, 15 min), the pellet was rinsed by adding 1.0 ml of 70% (vol/vol) ethanol and leaving this in the tube for 5 min at 4 C. The ethanol was removed, and the pellet was dried in vacuo. The pellet was resuspended in 125 p.1 of TE buffer, and 20 p.1 of boiled RNase A in TE buffer was added. Following incubation (37 C, 60 min), the DNA was reprecipitated with ethanol and NaCI and then washed and dried as described above. After being suspended in 125 p.1 of TE buffer, the concentration and purity of the DNA preparations were determined by measuring the optical density at 260 and 280 nm (21). Polymerase chain reaction. The polymerase chain reaction was used as a method to expand a segment of rdna covering two ITSs and the 5.8S rdna (Fig. 1). The ITS5 and ITS4 primers, described by White et al. (28), were obtained from Genosys Biotechnologies, Inc., The Woodlands, Tex. These primers have been found to bind conserved sites in rdna from numerous fungal groups (28). The procedure for polymerase chain reaction utilized the protocol described by White et al. Briefly, the reaction mixture containing nucleotide triphosphates, buffer, and Taq polymerase (Ampligen kit; Perkin Elmer Cetus, Norwalk, Conn.), ITS5 and ITS4 primers (20 p.m each), and Trichosporon DNA (5 to 10 ng) was overlaid with mineral oil and placed on a thermal cycler (Perkin Elmer Cetus). The amplification conditions were the following. There was an initial denaturation for 2.5 min at 95 C, and then 35 cycles of annealing for 0.5 min at 55 C, followed by extension for 1.5 min at 72 C, and denaturation for 0.5 min at 95 C. After these cycles, the final extension was allowed to run for 10.0 min at 72 C. Following amplification, the expanded fragments were analyzed by agarose gel electrophoresis (21) using 2% (wt/vol) SeaKem GTG agarose (FMC BioProducts, Rockland, Maine; 40 mm Trisacetate buffer containing 1 mm EDTA, ph 8.0). Size markers were derived from 1?X174 cut with HaeIII (Bethesda Research Laboratories Technologies, Inc., Gaithersburg, Md.). Restriction enzyme digestion of polymerase chain reaction product. The polymerase chain reaction fragment was digested with 4-base recognition restriction enzymes Sau3A, Aliil. and HaeIlI under the conditions recommended and the buffers provided by the supplier (Bethesda Research Laboratories). The fragments sizes were then analyzed by using agarose gel electrophoresis as for the polymerase chain reaction product. 1680 KEMKER ETAL.J.CN.MROO. CLIN. MICROBIOL. Strain TABLE 3. Matrix showing enzyme electrophoresis data for T. beigeiji strains Enzyme activity in position : A BC DE F GH IJ KLM NOP Q R STU VW X Y Zaabc dcef ghij k Im n opq r TSAS-87P TSAS-87R TSAS-87PG TSAS-87RG UMSMT UMSMT UMSMT TCM Absence (0) and presence (1) of band of activity for oa-glucosidase (columns A to C). P-glucosidase (columns D to F), catalase (columns G to L), superoxide dismutase (columns M to Q), glucose-6-phosphate dehydrogenase (columns R to T), malate dehydrogenase (columns U to Y). esterases based on ot-naphthyl acetate (columns Z to i, not included in cluster analyses [see text]), esterases based on 4-methylumbelliferyl acetate (columns j to r). RESULTS Physiological tests. The strains of T. beigelii showed some heterogeneity in their abilities to assimilate uric acid, glycine, inositol, sorbitol, trehalose, melezitose, and raffinose (Table 1). However, there was no clear pattern that characterized organisms as belonging to one of the clinical groups or as being a nonclinical isolate. Three of the four morphological variants of TSAS-87 behaved identically in their abilities to utilize different carbon compounds; however, TSAS-87PG differed from the others in being able to assimilate melezitose. The positive diazonium blue B test for all strains was in agreement with the described basidiomycetous affinity of T. beigelii. Isoenzyme profiles. Table 3 shows the pattern of enzyme bands seen for the different strains of T. beigeiji. Heterogeneity was detected in the patterns of bands of enzyme activity that developed on the polyacrylamide gels. Examples of the heterogeneity found are shown in Fig. 2. Glucose- 6-phosphate dehydrogenase, ot-glucosidase, and P3-glucosidase activities were observed in three different positions each, catalase was found in six different positions, superoxide dismutase activity and malate dehydrogenase were found in five different positions, and esterases, detected with 4-methylumbelliferyl acetate, were present in nine positions. In addition to these enzyme stains, stains for mannitol dehydrogenase and acid phosphatase were performed, but there was poor resolution of the bands of activity. No bands of activity were observable in gels stained for alkaline phosphatase or for sorbitol dehydrogenase. A valuable feature of the isoenzyme assay was its ability to detect unrelated organisms. For example, another strain that showed very different isoenzyme profiles turned out to be a contaminant; it was diazonium blue B negative. Cluster analyses. Cluster analysis was applied to the data, and strains were clustered for similarity on the basis of the enzyme patterns alone or the enzyme patterns with the carbon compound utilization data. Because very similar esterase profiles were obtained with 4-methylumbelliferyl acetate and ot-naphthyl acetate as substrates, the results A. SOt) u3 fi.. C. Esterase.1 :..:.n-::- :;.,.: WiMMMIN 'WI.i D. E k I a se v 11 0 It *.i,i s:., 1'. UPIA FIG. 2. Isoenzyme variation in T. beigeiji. Superoxide dismutases (SOD) (A), as-glucosidases (B), and esterases (C) stained with 4-methylumbelliferyl acetate of (lanes 1 to 10, respectively) MC0585, , , , TCM-86, 10266, 11115, 14905, 28574, and (D) Esterases of seven strains obtained from blood and of two unrelated strains. Lanes i to 9, TSAS-87P, TSAS- 87R, TSAS-87PG, TSAS-87RG, UMSMT-1, UMSMT-2, UMSMT- 3, 28574, and (lane 10 was left empty). MC0585 was a contaminant unlike T. beigelii; almost no activity was observed for it or for in the gel stained for at-glucosidase (B). Although extra bands of esterase activity may be seen in panel D when compared with panel C, for example, in strain 38300, replicate gels did not regularly show these bands, so they have not been included in Table 3 or in the cluster analyses. VOL. 29, 1991 A. Centroid linkage - All tests T. BEIGELII GENETIC HETEROGENEITY 1681 B. Centroid linkage - lsoenzymes only -- X _ B UMSMT-2 B TSAS-87RG B UMSMT-1 B TSAS-87R G M B I - B TCM-86 - M ' B N N I I N ' - -- S I I N S C. Average linkage - All tests B UMSMT-2 B TSAS-87RG B UMSMT-1 B TSAS-87R - G M B B TCM I M B _, N I-- N I N S t-- N S B UM
Search
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x