Environment

The DNA Binding Domain of a Papillomavirus E2 Protein Programs a Chimeric Nuclease To Cleave Integrated Human Papillomavirus DNA in HeLa Cervical Carcinoma Cells

Description
The DNA Binding Domain of a Papillomavirus E2 Protein Programs a Chimeric Nuclease To Cleave Integrated Human Papillomavirus DNA in HeLa Cervical Carcinoma Cells
Categories
Published
of 11
13
Categories
Published
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Similar Documents
Share
Transcript
  J OURNAL OF  V IROLOGY , June 2007, p. 6254–6264 Vol. 81, No. 120022-538X/07/$08.00  0 doi:10.1128/JVI.00232-07Copyright © 2007, American Society for Microbiology. All Rights Reserved. The DNA Binding Domain of a Papillomavirus E2 Protein Programs aChimeric Nuclease To Cleave Integrated Human PapillomavirusDNA in HeLa Cervical Carcinoma Cells  Stacy M. Horner 1 and Daniel DiMaio 2,3 * Graduate Program in Microbiology 1  and Departments of Genetics 2  and Therapeutic Radiology, 3 Yale University School of Medicine, 333 Cedar Street, New Haven, Connecticut 06510 Received 2 February 2007/Accepted 21 March 2007  Viral DNA binding proteins that direct nucleases or other protein domains to viral DNA in lytically orlatently infected cells may provide a novel approach to modulate viral gene expression or replication. Cervicalcarcinogenesis is initiated by high-risk human papillomavirus (HPV) infection, and viral DNA persists in thecancer cells. To test whether a DNA binding domain of a papillomavirus protein can direct a nuclease domainto cleave HPV DNA in cervical cancer cells, we fused the DNA binding domain of the bovine papillomavirustype 1 (BPV1) E2 protein to the catalytic domain of the FokI restriction endonuclease, generating a BPV1E2-FokI chimeric nuclease (BEF). BEF introduced DNA double-strand breaks on both sides of an E2 bindingsite in vitro, whereas DNA binding or catalytic mutants of BEF did not. After expression of BEF in HeLacervical carcinoma cells, we detected cleavage at E2 binding sites in the integrated HPV18 DNA in these cellsand also at an E2 binding site in cellular DNA. BEF-expressing cells underwent senescence, which required theDNA binding activity of BEF, but not its nuclease activity. These results demonstrate that DNA bindingdomains of viral proteins can target effector molecules to cognate binding sites in virally infected cells. Viral genomes present in lytically and latently infected cellsprovide unique DNA sequences that are absent from unin-fected cells. Proteins that bind directly to viral or proviral DNA could act selectively in infected cells to modulate specific viralprocesses, such as gene expression or replication. ArtificialDNA binding domains containing Cys 2 -His 2  zinc finger motifshave been engineered to direct functional protein domains toDNA sequences of interest (61). These zinc finger proteins(ZFPs) have been used to construct designer transcriptionfactors to activate or repress genes or to create site-specificendonucleases (reviewed in reference 36). ZFPs linked to theKru¨ppel-associated box repressor domain bind to and represspromoters of human immunodeficiency virus type 1 and herpessimplex virus type 1 (37, 43, 46), illustrating that engineeredproteins can bind to specific sites in viral genomes. In addition,ZFPs designed to bind specific sites in human papillomavirus(HPV) DNA are able to inhibit the replication of HPV type 18(HPV18) in transient replication assays (32).The FokI restriction enzyme, a modular type IIS restrictionenzyme, has a nonspecific nuclease domain that cleaves DNA adjacent to the recognition site of its DNA binding domain (27,54). Engineered ZFPs and DNA binding modules of cellularproteins have been fused to the FokI nuclease domain tocreate site-specific endonucleases that can introduce DNA double-strand breaks at desired sequences (14, 21, 23–25, 45,50, 51). The DNA binding domains of viral proteins have notbeen used to target chimeric nucleases to induce cleavage of  viral DNA. ZFP-FokI-based nucleases have been used to stim-ulate homologous recombination in  Xenopus  oocytes and toenhance gene targeting in  Drosophila  and in human somaticcells (4–6, 41). The native FokI enzyme, as well as FokI-basedchimeric nucleases, requires dimerization of the nuclease do-main for efficient DNA cleavage (7, 57, 59). Although ZFPs can be engineered to recognize many DNA sequences, the development and optimization of ZFPs thatrecognize particular sequences can be a lengthy and difficultprocess involving serial rounds of mutagenesis and selection.Furthermore, it has not been possible to generate highly se-quence-specific ZFPs to some DNA sequences (35, 47). There-fore, we decided to test whether the DNA binding domain of a native viral protein could be used to direct a functionalheterologous protein domain to viral DNA in infected cells.Viruses contribute to the development of more than 10% of cancers worldwide (38). The high-risk HPVs, including types16 and 18, play a central role in the development of cervicaland other cancers, and HPV DNA is invariably present andoften integrated into cellular DNA in cervical cancer cells (11).The HPV E6 and E7 oncogenes are expressed in cervicalcarcinomas and cell lines derived from them and encode pro-teins that inactivate cellular growth controls. The HPV E6protein binds to the p53 tumor suppressor and targets it forubiquitin-mediated degradation, and it induces expression of telomerase (29). The HPV E7 protein binds to hypophosphor- ylated members of the retinoblastoma (Rb) tumor suppressorfamily, resulting in their destabilization and loss of Rb/E2Fcomplexes, thereby allowing the expression of cell cycle pro-gression genes (33).Continuous expression of the HPV oncogenes is requiredfor the proliferation of cervical cancer cell lines. In cervicalcancer, integration of HPV DNA into the cellular genomeoften disrupts expression of the HPV E2 gene (3, 48), whichencodes a dimeric, site-specific DNA binding protein required * Corresponding author. Mailing address: Yale University School of Medicine, Department of Genetics, 333 Cedar Street, SHM-141, NewHaven, CT 06510. Phone: (203) 785-2684. Fax: (203) 785-6765. E-mail:daniel.dimaio@yale.edu.  Published ahead of print on 28 March 2007.6254   onA  pr i  l   6  ,2  0 1  8  b  y  g u e s  t  h  t   t   p:  /   /   j  v i  . a s m. or  g /  D  ownl   o a d  e d f  r  om   for viral DNA replication, proper viral gene expression, andgenome segregation (30). Loss of E2 results in the derepres-sion of E6 and E7 expression and may play a key role leadingtoward cancer progression. When the E2 gene from bovinepapillomavirus type 1 (BPV1) is introduced into HeLa cervicalcarcinoma cells, which contain integrated HPV18 DNA, theE2 protein binds to the E2 binding sites (BSs) in the HPVmajor early promoter, causing transcriptional repression of theE6 and E7 oncogenes. This results in restoration of p53 and Rbactivity, inhibition of cellular growth, and entry into a state of cellular senescence (13, 15, 16a, 22, 55).The E2 protein, the only papillomavirus protein that inde-pendently binds viral DNA with high affinity and site-specific-ity, has a modular structure. The full-length E2 protein con-tains an amino-terminal transcriptional regulatory domain anda carboxy-terminal DNA binding and dimerization domainsufficient for specific DNA recognition, separated by a phylo-genetically unconserved hinge region (reviewed in references18 and 31). An E2 dimer binds to the consensus sequence ACCgN 4 cGGT (lowercase letters are preferred but not re-quired, N 4  denotes a spacer region) (28) present in multiplecopies in papillomavirus genomes. The HPV16 and -18 ge-nomes contain four conserved E2 BSs, all of which are in the viral long control region, including two (BS1 and BS2) imme-diately upstream of the promoter for the E6 and E7 oncogenes(28, 44, 55). The E2 protein from a variety of papillomavirustypes binds to these E2 BSs, resulting in repression of the E6and E7 genes. Thus, the well-characterized papillomavirus E2protein can be used to test whether a viral DNA bindingdomain can target an effector protein to viral DNA sequences.Here, we report the generation of a chimeric nuclease thatinduces DNA double-strand breaks at E2 BSs in purified DNA substrates in vitro and in the integrated HPV18 genomes inHeLa cervical carcinoma cells, as well as at a nonviral E2 BS incellular DNA. MATERIALS AND METHODSConstruction and expression of BEF.  BPV1 E2-FokI chimeric nuclease (BEF) was constructed by using recombinant PCR with overlapping primers to link theBPV1 E2 DNA binding domain (amino acids 310 to 410) to the glycine linker(Gly 4 Ser) 3 -FokI nuclease domain (amino acids 383 to 579) from pET15b:ZIF  QNK (a generous gift from S. Chandrasegaran, Johns Hopkins) (50). Forexpression by in vitro transcription and translation, the PCR product encodingBEF was digested with XhoI and BamHI and subcloned into pET15b (Novagen), where expression is driven by a T7 promoter, to make pET15b-BEF, and thesequence was confirmed. BEF was transcribed and translated by using the TNTT7 quick coupled transcription/translation system (Promega) according to themanufacturer’s instructions. Mock lysates were programmed with the pET15bempty vector.To make adenovirus stocks, the BEF construct was subcloned into the shuttle vector pDualCCM (Vector Biolabs) to create pDualCCM-BEF. BEF was trans-ferred from the shuttle vector into the viral genome by homologous recombina-tion, stocks of recombinant replication-defective adenovirus with E1/E3 deleted were made and amplified, and titers were determined by Vector Biolabs (Phil-adelphia, PA).pET15b-BEF was used as a template in standard site-directed mutagenesisreactions (QuikChange; Stratagene) to generate the following mutations: BEF-C340R (refers to E2 residue 340) and BEF-D467A (refers to FokI residue 467).PCR was used to add BamHI and XhoI restriction sites to BEF-C340R andBEF-D467A for subcloning into pDualCCM for the generation of adenovirusstocks, as described above. DNA substrates.  For in vitro digestion assays, plasmids containing an E2 BS were constructed by insertion of oligonucleotide duplexes containing HPV16 E2BS1, BPV1 E2 BS10, or HPV18 E2 BS1 (see Table 1 for E2 BS sequences) intothe PstI site in pACYC177 (New England Biolabs [NEB]). A total of 10  g of theresulting plasmids was digested with BamHI and HindIII, and the resulting3.1-kb bands, which lack endogenous E2 BSs, were gel purified. pSH99 wasconstructed by removing the E2 BSs in pUC19 by QuikChange site-directedmutagenesis of position 1388 from a C to a T and replacement of the NdeI-to-EcoRI fragment containing an E2 BS with the NdeI-to-EcoRI fragment of pET15b, which does not contain an E2 BS. In vitro digestion assays.  Approximately 800 ng of gel-purified linear substrateDNA were incubated in 20 mM Tris-acetate (pH 7.9), 10 mM magnesiumacetate, 50 mM potassium acetate, 1 mM dithiothreitol (i.e., restriction enzymebuffer 4 from NEB), 0.1 mg of bovine serum albumin/ml, and 3   l of the TNTlysates at room temperature for 30 min. After digestion, the samples were treated with 10   g of DNase-free RNase (catalog no. 11119915001; Roche AppliedScience)/ml for 1.5 min, phenol-chloroform extracted, ethanol precipitated, re-suspended in 20   l of 10 mM Tris-HCl (pH 8.0)–1 mM EDTA buffer, andsubjected to electrophoresis on 1% agarose gels. The products were run along-side a 1-kb DNA ladder (Gibco) and 0.9- and 2.2-kb size markers generated fromPstI digestion of substrate DNA without an E2 BS. In some experiments, theprotocol was modified as follows: 500 ng of substrate DNA and 4   l of TNTlysate were used, and the incubation was done at 30°C. Variation of the incuba-tion temperature (room temperature or at 30 or 37°C) did not significantly alterthe cleavage properties or extent of digestion by the chimeric nuclease. Cells.  The HeLa/sen2 line was described previously (15). HeLa/sen2, Cos-1,and C33A cells were maintained in Dulbecco modified Eagle medium supple-mented with 10% fetal bovine serum, penicillin-streptomycin, and 20 mMHEPES (pH 7.3). LM-PCR of DNA double-strand breaks. (i) From digestion with in vitrotranscribed or translated BEF.  Pairs of complementary oligonucleotides (07769and 010067, left; 07769 and 014621, right; see Table 2 for the sequences of allprimers) were annealed to generate double-stranded linkers with 5   overhangscomplementary to the mapped overhangs after BEF cleavage. BEF-cleavedsubstrate DNA containing the HPV18 E2 BS was ligated to 7 pmol of theappropriate linker in a total volume of 20   l overnight at 18°C with T4 DNA ligase buffer and T4 DNA ligase (NEB). After heat inactivation of the ligase, 1  l of a 1:10 dilution of the linker-ligated DNA was added to 50  l (final volume)of PCR mixture with  Taq  DNA polymerase (NEB) and SPLKO (linker-specificouter primer, see Table 2) and either L-1 or R-1 substrate-specific primers. ForPCR, the cycling conditions were as follows: initial denaturation at 95°C for 4min and 10 cycles of heating (95°C, 45 s), annealing (60°C, 1 min), and elongation(72°C, 1 min). The PCR product was purified by using a QIAGEN PCR purifi-cation kit, and 1   l of the sample was used as the template for a second roundof PCR with the nested primers SPLKI (linker-specific nested primer, see Table2) and either L-2 or R-2. The cycling conditions were as follows: initial dena-turation at 95°C for 4 min, 25 cycles of heating (95°C, 45 s), annealing (62°C,45 s), and elongation (72°C, 1 min). The reaction products were subjected toagarose gel electrophoresis and run alongside a 100-bp DNA ladder (Invitrogen). (ii) From digestion with cell lysates expressing BEF.  4    10 5 HeLa/sen2 cells were seeded into 100-mm dishes and the next day mock-infected or infected ata multiplicity of infection (MOI) of 100 with Ad-BEF, Ad-BEF-C340R, Ad-BEF-D467A, or Ad-CMV (Vector Biolabs). Two days later, cell pellets wereharvested and frozen. The cell pellets were lysed in FN-CD lysis buffer (10 mMTris, 50 mM NaCl, 0.1 mM EDTA, 200   g of bovine serum albumin/ml, 0.5%CHAPSO {3-[(3-cholamidopropyl)-dimethylammonio]-2-hydroxy-1-propanesul-fonate}, 0.25 mM deoxycholate, 50% glycerol [pH 7.4]) containing 5   g of leupeptin and aprotinin/ml. DNA substrates containing no E2 BS or a BPV1 E2BS were incubated with 10   g of cleared lysate at 37°C for 30 min. Afterphenol-chloroform-extraction and ethanol precipitation, the samples were dis-solved in 20  l of 10 mM Tris-HCl (pH 8.0)–1 mM EDTA buffer. Ligation to thedouble-strand linker (07769 and 07770) and LM-PCR was done as described inthe preceding paragraph using 62°C as the annealing temperature for the first TABLE 1. E2 binding sites E2 BS Sequence (5   to 3  )  a BPV1 BS10 ............................................................ACCGTCTTCGGTHPV16 BS1............................................................ACCGAAACCGGTHPV18 BS1............................................................ACCGAAAACGGT  a HPV18 BS2............................................................ACCGAAAACGGT  a HPV18 BS3............................................................ACCGAAATAGGTHPV18 BS4............................................................ACCGATTTCGGT  a HPV18 BS1 and BS2 are identical. V OL  . 81, 2007 BPV1 E2-FokI CHIMERIC NUCLEASE CLEAVES HPV18 DNA 6255   onA  pr i  l   6  ,2  0 1  8  b  y  g u e s  t  h  t   t   p:  /   /   j  v i  . a s m. or  g /  D  ownl   o a d  e d f  r  om   round of the PCR and R-1 and R-2 as the nested primer set. The reactionproducts were subjected to agarose gel electrophoresis and run alongside a100-bp DNA ladder. (iii) From digestion of genomic DNA in HeLa cells.  5    10 5 HeLa/sen2 cells were seeded into 100-mm dishes and the next day infected at an MOI of 10 with Ad-CMV as a negative control or with Ad-BEF. Thirty hours later, cell pellets were harvested and frozen. Genomic DNA was prepared with a Genomic Tip(QIAGEN). Prior to linker ligation, T4 DNA polymerase and 0.2 mM concen-trations of all four deoxynucleoside triphosphates were used to blunt staggeredDNA lesions. After purification using a QIAGEN PCR purification kit, 200 ng of the blunted DNA was ligated with T4 DNA ligase to 7 pmol of a double-strandedblunt-ended linker (07769 and 09893) in a total volume of 60   l overnight at18°C. For PCR, 5  l of ligated DNA was added to 50  l of reaction mixture withprimers specific for the linker and the relevant locus (see Table 2) and  Taq  DNA polymerase. The reaction mixture was incubated for 5 min at 72°C, followed byPCR as described above with the appropriate locus-specific primers. Half of thePCR product was resolved by electrophoresis on either a 2 or a 4% NuSieveagarose gel (Cambrex), transferred to a Nytran Supercharge membrane (Schlei-cher & Schuell) under neutral conditions, and cross-linked to the membrane byUV irradiation with a Stratalinker (Stratagene). The blots were hybridized withrandom-prime-labeled DNA fragments or a  32 P-labeled oligonucleotide locus-specific probe and analyzed with a PhosphorImager. DNA sequence analysis of LM-PCR products.  Amplified LM-PCR products were purified on 2% agarose gels. Gel extraction and purification was done withthe QIAGEN MinElute gel extraction kit. The purified DNA was cloned into aTOPO cloning vector (Invitrogen), and individual clones were sequenced. Immunoblotting.  Protein from in vitro transcription and translation or fromextracts of cells harvested in modified EBC buffer (50 mM Tris-HCl [pH 7.5], 120mM NaCl, 2 mM EDTA, 0.4% NP-40, 1 mM NaF, 1 mM Na orthovanadate, 1mM phenylmethylsulfonyl fluoride, and 5  g of leupeptin, and aprotinin/ml) wassubjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, trans-ferred to an Immobilon-P membrane (Millipore) in a 12.5 mM Tris–0.1 Mglycine–20% methanol transfer buffer, and blocked in 5% milk-tris-bufferedsaline buffer. The membranes were probed with rabbit antiserum raised againstthe FokI endonuclease (a gift from S. Chandrasegaran, Johns Hopkins). Themembranes were washed in TBS, incubated with rabbit horseradish peroxidase-conjugated donkey antibody (Jackson Immunoresearch), and washed again withTBS. The membranes were then incubated with ECL    (Amersham), and thesignals were detected with Hyperfilm (Amersham). Immunoblotting for E2 witha 1:10 dilution of the B202 tissue culture supernatant was done as describedpreviously (16).  Autofluorescence.  A total of 2  10 5 HeLa/sen2 cells were seeded into 100-mmdishes and the next day were infected with Ad-CMV, Ad-BEF, Ad-BEF-C340R,or Ad-BEF-D467A (MOI of 100). Flow cytometry assays were performed 5 dayspostinfection, as described previously (10). SA   -Gal assay.  A total of 2    10 5 HeLa/sen2 or C33A cells were seeded into100-mm dishes and the next day were mock infected or infected with either Ad-GFP (Vector Biolabs) as a control or Ad-BEF at an MOI of 100. After 5days, 5    10 4 cells were replated into six-well dishes. Ten days after the initialinfection, the cells were stained at pH 6.0 with X-Gal (5-bromo-4-chloro-3-indolyl-  - D -galactopyranoside) as described previously (12). RESULTS We used recombinant PCR to construct a gene that encodesa chimeric nuclease (BEF) comprised of the DNA bindingdomain and a portion of the hinge region of the BPV1 E2protein (amino acids 310 to 410) fused in-frame N-terminal tothe nuclease domain of the FokI endonuclease (amino acids383 to 579) (Fig. 1A). The crystal structure of a dimer of theBPV1 E2 DNA binding domain bound to DNA revealed thatthe C terminus of the protein points away from the dimerinterface and the DNA double helix, suggesting that addingprotein sequences to the C terminus of the E2 protein wouldnot interfere with its ability to dimerize or bind DNA (19). Weused the C-terminal 101 amino acids of the E2 protein becausethis portion of the protein has increased stability and affinityfor DNA compared to the minimal 85-amino-acid DNA bind-ing domain (39). This region of E2 also contains a nuclearlocalization signal (1, 49). The nuclease domain of FokI used inthese experiments has been well characterized and lacks site-specific DNA binding activity (27, 28, 58). A flexible 15-amino-acid glycine-serine linker [(Gly 4 Ser) 3 ] separated the two do-mains. Chimeric nuclease cleaves DNA substrates containing E2BSs.  The chimeric nuclease was expressed from a T7 promoterin a coupled in vitro transcription and translation system con-taining T7 RNA polymerase. Immunoblotting with a FokI an-tiserum or an E2 monoclonal antibody detected the chimericnuclease at its predicted molecular weight (data not shown). TABLE 2. Oligonucleotides used for LM-PCR Function andoligonucleotide Sequence (5   to 3  ) Function PCRSPLKO CGAATCGTAACCGTTCGTACGAGAA Linker-specific outer primerSPLKI TCGTACGAGAATCGCTGTCCTCTCC Linker-specific nested primerL-1 TTGCCTTCCTGTTTTTGCT Left outer primer; pACYC177L-2 CCGAAGGAGCTAACCGC Left nested primer; pACYC177R-1 GCCAGTTACCTCGGTTCAA Rt. outer primer; pACYC177R-2 GATACGGGAGGGCTTACCAT Rt. nested primer; pACYC1771-1 ACCTTCTGGATCAGCCATTG HPV18 E2BS1 outer primer1-2 CTGGATTCAACGGTTTCTGG HPV18 E2BS1 nested primer4-1 CGTGTACGTGCCAGGAAGT HPV18 E2BS4 outer primer4-2 TGTGTTTGTATGTCCTGTGTTTGTG HPV18 E2BS4 nested primer13-1 TTTAAGAGGGAAAAGTCTAGGTTTCA Chromosome 13 outer primer13-2 TTCACAATCCAAAGGCAACA Chromosome 13 nested primerLinkers07769 CGAATCGTAACCGTTCGTACGAGAATTCGTACGA GAATCGCTGTCCTCTCCAACGAGCCAAGA Top linker09893 TCTTGGCTCGTTTTTTTTTGCAAAAA Bottom linker: blunt ends07770 CTGCTCTTGGCTCGTTTTTTTTTGCAAAAA Bottom linker: BE2010067 GTCGTCTTGGCTCGTTTTTTTTTGCAAAAA Bottom linker: HPV18, left014621 TATATCTTGGCTCGTTTTTTTTTGCAAAAA Bottom linker: HPV18, right6256 HORNER AND D I MAIO J. V IROL  .   onA  pr i  l   6  ,2  0 1  8  b  y  g u e s  t  h  t   t   p:  /   /   j  v i  . a s m. or  g /  D  ownl   o a d  e d f  r  om   To determine whether BEF cleaved DNA containing E2 BSs, we incubated the in vitro transcribed and translated BEF withpurified linear 3.1-kb DNA substrates lacking an E2 BS orcontaining a single E2 BS derived from BPV1 or HPV16 DNA (see Table 1 for the sequences of the E2 BSs). These substrates were identical other than the presence or absence of the E2BS. BEF digestion generated specific cleavage products of thepredicted size of 0.9 and 2.2 kb (Fig. 1B) with substrates con-taining an E2 BS from BPV1 or HPV16 (Fig. 1C, lanes 7 and8). In contrast, no specific cleavage occurred in the substrateslacking an E2 BS (Fig. 1C, lane 6) or if a mock transcription-translation mix was used (Fig. 1C, lanes 3 to 5). These resultsindicated that BEF cleaves DNA at or near the E2 BS, and thatcleavage requires only a single E2 BS. The presence of undi-gested DNA demonstrated that the cleavage reaction did notproceed to completion. The overall extent of cleavage was variable from experiment to experiment and not reproduciblyincreased by using substrates containing multiple E2 BSs (datanot shown). BEF also specifically cleaved a DNA substratecontaining E2 BS1 from HPV18 DNA (Fig. 1D, lane 5). Inaddition, a chimeric nuclease with a DNA binding domainfrom the HPV16 E2 protein generated specific cleavage prod-ucts of 0.9 and 2.2 kb from substrates containing an HPV16 E2BS, but was unable to cleave DNA substrates containing aBPV1 E2 BS with an A/T-poor spacer (data not shown), afinding consistent with the preference of the HPV16 E2 pro-tein for E2 BSs with an A/T-rich spacer (20).To test whether DNA binding was required for cleavage, weused site-directed mutagenesis to generate a cysteine-to-argi-nine mutation at position 340 in the E2 DNA binding domainof BEF, which impairs DNA binding (42). The DNA bindingmutant displayed greatly reduced ability to cleave a DNA sub-strate containing an E2 BS (Fig. 1D, lane 7), demonstratingthat BEF required DNA binding for efficient cleavage. To test whether the nuclease activity of BEF was required for cleav-age, we also generated an aspartic acid-to-alanine mutationat position 467 in the FokI nuclease domain of BEF, whichabolishes its catalytic activity (59). The catalytic mutant wasunable to cleave a DNA substrate containing an E2 BS (Fig.1D, lane 9), demonstrating that the catalytic activity of FokI was also required for BEF cleavage. Both mutants wereexpressed at levels similar to that of wild-type BEF (data notshown). Mapping sites of cleavage by BEF.  To determine the precisesites of cleavage relative to the E2 BS, we used DNA substratescontaining the HPV18 E2 BS1 that were  32 P end labeled ateither the 5   or the 3   end. After BEF digestion, the productsof the cleavage reaction were analyzed by denaturing high FIG. 1. Chimeric nuclease (BEF) containing the E2 DNA binding domain and FokI nuclease domain cleaves DNA substrates containing anE2 BS. (A) Schematic diagram of the BEF chimeric nuclease. The BPV1 E2 DNA binding domain (amino acids 310 to 410), shown in gray, wasfused to the FokI nuclease domain (amino acids 383 to 579) in black by a glycine-serine linker, shown in white. (B) E2 BS substrate. Linear DNA substrates, with or without the E2 BS (at the location noted by the arrow) were used to test the activity of the chimeric nuclease. The approximatesizes of the cleavage products are noted. (C) The BEF chimeric nuclease cleaves DNA substrates containing E2 BSs. After digestion of substrateDNA containing no E2 BS (0), a BPV1 E2 BS (B), or an HPV16 E2 BS (H) with in vitro transcribed and translated BEF or a mock lysate, cleavageproducts were separated from uncut DNA by agarose gel electrophoresis and are noted by the arrows. Lane 1 shows a 1-kb DNA ladder, and lane2 shows marker DNA fragments of the predicted sizes of the cleavage products. (D) The DNA binding and catalytic activity of BEF are requiredfor DNA cleavage. BEF, BEF-C340R (the DNA binding mutant), BEF-D467A (the catalytic mutant), or a mock lysate were incubated withsubstrate DNA containing no E2 BS (0) or an HPV18 E2 BS (H). The cleavage products were separated by agarose gel electrophoresis and arenoted by the arrows. The ladder and markers (lane 10) are the same as in panel C.V OL  . 81, 2007 BPV1 E2-FokI CHIMERIC NUCLEASE CLEAVES HPV18 DNA 6257   onA  pr i  l   6  ,2  0 1  8  b  y  g u e s  t  h  t   t   p:  /   /   j  v i  . a s m. or  g /  D  ownl   o a d  e d f  r  om   percentage polyacrylamide gel electrophoresis, followed by au-toradiography (data not shown). Figure 2A summarizes themapping analysis of the cleavage of the end-labeled DNA substrates. These mapping data demonstrated that BEFcleaved substrate DNA on either side of the E2 BS to generatedouble-strand breaks. As was the case in previous studies of FokI-mediated cleavage, there was a slight heterogeneity of the sites of strand scission, with the predominant cleavageproducts having four-nucleotide 5   overhangs (50, 51). A variant of LM-PCR was used to confirm that BEF cleav-age generated the four-nucleotide 5   overhangs mapped withthe end-labeled DNA. After digestion of substrates with or without HPV18 E2 BS1, a linker containing an overhang com-plementary to the predicted four-nucleotide overhang on theright or left of the E2 BS was ligated to the BEF-digestedDNA. Nested PCR using primers specific to the linker and theappropriate flanking substrate DNA was used to amplify theligation products (see Fig. 2A), which were subjected to aga-rose gel electrophoresis (Fig. 2B). No PCR product was de-tected when ligase or BEF was omitted from the reaction (datanot shown) or when the substrate lacked an E2 BS. However, when linkers with overhangs complementary to the mappedoverhangs near the E2 BS were ligated to DNA cleaved byBEF, discrete products of the expected size were amplified(Fig. 2B). Cloning and sequencing of the PCR products con-firmed that they were all the result of linker ligation at thepredicted site, including the faint upper band in the right-sidePCR, which was generated by a duplication of the flankingsubstrate DNA primer in the PCR product (data not shown).This experiment confirmed that BEF cleaves at least somesubstrate DNA to generate double-strand breaks with 5   over-hangs of four nucleotides on both sides of the E2 BS. Cell lysates expressing BEF cleave DNA substrates at E2BSs.  To test whether BEF expressed in cells was active, wegenerated replication-defective adenovirus vectors expressingthe wild-type chimeric nuclease (Ad-BEF), the DNA bindingmutant (Ad-BEF-C340R), and the catalytic mutant (Ad-BEF-D467A). HeLa cervical carcinoma cells were infected at anMOI of 100 with these viruses, a control adenovirus, or mockinfected. Two days after infection, the cell lysates were har- vested and incubated in vitro with DNA substrates containingno E2 BS or an E2 BS derived from BPV1 DNA. LM-PCR, asdescribed above, was used to detect cleavage and generation of a four-nucleotide 5   overhang 2 bp away from the E2 BS (Fig.3). No specific cleavage was detected in substrates lacking anE2 BS (data not shown) or when substrates were incubated with a lysate from the cells that were mock infected or infected with the control adenovirus (Fig. 3, lanes 1 and 2). Cleavageadjacent to the E2 BS was detected by LM-PCR after incuba-tion of the substrate with lysates from cells infected with Ad-BEF (Fig. 3, lane 3). BEF containing a mutation in either the FIG. 2. Mapping the sites of cleavage by BEF. (A) Diagram of the substrate DNA used in digestion and mapping reactions indicating theposition of the E2 BS and the left-side (L-1 and L-2) and right-side (R-1 and R-2) PCR primers. The dotted lines indicate the predicted sizes of the respective PCR products. The sequence of the E2 BS and flanking DNA, as well as the sequence of the linkers with single-strand overhangs,are shown at the bottom. The major sites of cleavage mapped on BEF-digested end-labeled DNA substrates are indicated by arrows, with the majorfour-base overhangs on each side of the BS shown. (B) After BEF digestion of DNA substrates containing an HPV18 E2 BS (  ) or no E2 BS (  ),a left-side or right-side linker was ligated to the DNA. The ligation products were amplified by PCR with linker-specific primers in combination with nested primers specific for the appropriate flanking substrate DNA and subjected to agarose gel electrophoresis along with a 100-bp DNA ladder shown in the far left lane of each gel.FIG. 3. Cell lysates expressing BEF cleave DNA substrates with aBPV1 E2 BS in vitro. HeLa cells were infected with adenoviruses(MOI of 100) expressing BEF, BEF-C340R (the DNA binding mu-tant), BEF-D467A (the catalytic mutant), a control adenovirus (vec-tor), or mock infected. Two days after infection, cell lysates wereharvested and incubated in vitro with DNA substrates containing aBPV1 E2 BS. LM-PCR was used to detect cleavage and generation of four-nucleotide 5   overhangs on the right side of the E2 BS.6258 HORNER AND D I MAIO J. V IROL  .   onA  pr i  l   6  ,2  0 1  8  b  y  g u e s  t  h  t   t   p:  /   /   j  v i  . a s m. or  g /  D  ownl   o a d  e d f  r  om 
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x