Travel & Places

Genetic basis of the impaired renal myogenic response in FHH rats

Description
Genetic basis of the impaired renal myogenic response in FHH rats
Published
of 14
5
Published
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Transcript
  doi: 10.1152/ajprenal.00404.2012304:F565-F577, 2013. First published 5 December 2012;  Am J Physiol Renal Physiol Williams, Allison Sarkis, Jozef Lazar, Howard J. Jacob and Richard J. RomanMarilyn Burke, Malikarjuna Pabbidi, Fan Fan, Ying Ge, Ruisheng Liu, Jan Michael FHH ratsGenetic basis of the impaired renal myogenic response in You might find this additional info useful...  49 articles, 33 of which you can access for free at: This article citeshttp://ajprenal.physiology.org/content/304/5/F565.full#ref-list-1 including high resolution figures, can be found at: Updated information and serviceshttp://ajprenal.physiology.org/content/304/5/F565.fullfound at: can be  American Journal of Physiology - Renal Physiology about Additional material and informationhttp://www.the-aps.org/publications/ajprenalThis information is current as of March 18, 2013. 1522-1466. Visit our website at http://www.the-aps.org/. 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2013 the American Physiological Society. ESSN: volume and composition. It is published 24 times a year (twice monthly) by the American Physiological Society,relating to the kidney, urinary tract, and their respective cells and vasculature, as well as to the control of body fluid publishes srcinal manuscripts on a broad range of subjects  American Journal of Physiology - Renal Physiology   a t   U ni  v  of  Mi   s  s i   s  s i   p pi  M e d  C  en t   er  onM ar  c h 1  8  ,2  0 1  3 h  t   t   p:  /   /   a j   pr  en al  . ph  y  s i   ol   o g y . or  g /  D  ownl   o a d  e d f  r  om   Genetic basis of the impaired renal myogenic response in FHH rats Marilyn Burke, 1 Malikarjuna Pabbidi, 1 Fan Fan, 1 Ying Ge, 1 Ruisheng Liu, 2 Jan Michael Williams, 1 Allison Sarkis, 5 Jozef Lazar, 3,4 Howard J. Jacob, 3,5 and Richard J. Roman 1 1  Department of Pharmacology and Toxicology, University of Mississippi Medical Center, Jackson, Mississippi;  2  Department of Medicine, University of Mississippi Medical Center, Jackson, Mississippi;  3  Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin;  4  Department of Dermatology, Medical College of Wisconsin, Milwaukee, Wisconsin; and   5  Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin Submitted 18 July 2012; accepted in final form 4 December 2012 Burke M, Pabbidi M, Fan F, Ge Y, Liu R, Williams JM,Sarkis A, Lazar J, Jacob HJ, Roman RJ.  Genetic basis of theimpaired renal myogenic response in FHH rats.  Am J Physiol RenalPhysiol  304: F565–F577, 2013. First published December 5, 2012;doi:10.1152/ajprenal.00404.2012.—This study examined the effectof substitution of a 2.4-megabase pair (Mbp) region of Brown Norway(BN) rat chromosome 1 (RNO1) between 258.8 and 261.2 Mbp ontothe genetic background of fawn-hooded hypertensive (FHH) rats onautoregulation of renal blood flow (RBF), myogenic response of renalafferent arterioles (AF-art), K  channel activity in renal vascularsmooth muscle cells (VSMCs), and development of proteinuria andrenal injury. FHH rats exhibited poor autoregulation of RBF, whileFHH.1BN congenic strains with the 2.4-Mbp BN region exhibitednearly perfect autoregulation of RBF. The diameter of AF-art fromFHH rats increased in response to pressure but decreased in congenicstrains containing the 2.4-Mbp BN region. Protein excretion andglomerular and interstitial damage were significantly higher in FHHrats than in congenic strains containing the 2.4-Mbp BN region. K  channel current was fivefold greater in VSMCs from renal arteriolesof FHH rats than cells obtained from congenic strains containing the2.4-Mbp region. Sequence analysis of the known and predicted genesin the 2.4-Mbp region of FHH rats revealed amino acid-alteringvariants in the exons of three genes:  Add3 ,  Rbm20 , and  Soc-2 .Quantitative PCR studies indicated that  Mxi1  and  Rbm20  were dif-ferentially expressed in the renal vasculature of FHH and FHH.1BNcongenic strain F. These data indicate that transfer of this 2.4-Mbpregion from BN to FHH rats restores the myogenic response of AF-artand autoregulation of RBF, decreases K  current, and slows theprogression of proteinuria and renal injury.kidney; glomerulosclerosis; chronic renal failure; renal hemodynam-ics THE FAWN - HOODED HYPERTENSIVE  (FHH) rat is a genetic model of hypertension (33) that develops proteinuria, glomerulosclerosis(21, 30, 37, 47), and chronic kidney disease (22, 25–26,41–42). We have previously reported that the development of proteinuria and glomerular injury in FHH rats is associatedwith an impaired autoregulation of renal blood flow (RBF),glomerular filtration rate (GFR), and glomerular capillary pres-sure (Pgc) (24, 40, 43, 48). Genetic cosegregation studiesidentified five quantitative trait loci (QTLs) linked to thedevelopment of proteinuria in F2 crosses of FHH and August-Copenhagen inbred (ACI) rats (4–5, 36). The rat chromosome(RN) regions are  Rf-1  and  Rf-2  on RNO1,  Rf-3  on RNO3,  Rf-4 on RNO14, and  Rf-5  on RNO17. The  Rf-1  QTL is of particularinterest in that it lies within a region that is homologous to anarea on human chromosome 10 linked to the development of diabetic nephropathy (19) and end-stage renal disease (18).More recent studies identified a G-to-A mutation in the startcodon of   Rab38 , a gene in the  Rf-2  QTL that influences proteintrafficking and contributes to the development of proteinuria inFHH rats (32). However, the genes in the  Rf-1  region thatcontribute to the development of proteinuria and renal diseasein FHH rats and the mechanisms involved are unknown.We have previously reported that substitution of a 99.4-megabase pair (Mbp) region of RNO1 from Brown Norway(BN) into FHH rats, encompassing the  Rf-2  locus from markersD1Rat183 to D1Rat76, along with a 12.9-Mbp region in the  Rf-1  region of RNO1 (strain B, see Fig. 1) restored autoregu-lation of RBF and reduced proteinuria in this FHH.1BN doublecongenic strain (24). In contrast, autoregulation of RBF wasnot restored in a congenic strain in which only the 99.4-Mbpregion of RNO1 containing the  Rf-2  region was introgressed.Subsequently, we developed a subcongenic strain that nar-rowed the region of interest for autoregulation of RBF from12.9 to a smaller 4.7-Mbp region of RNO1 (48). However, thisregion was still too large for positional cloning of the genesinvolved, and studies using this double congenic strain areopen to the criticism that the restoration of the RBF autoreg-ulation phenotype could be due to an interaction of genes in thetwo independent introgressed regions of BN RNO1. Thus thepurpose of the present study was first to narrow the region of interest by creating and phenotyping two new FHH.1BN dou-ble congenic strains, D and E (genotypes presented in Fig. 1),and then to create and phenotype a minimal FHH.1BN con-genic, strain F, in which only the small region of BN RNO1near the  Rf-1  QTL was introgressed onto the FHH geneticbackground. We also compared the myogenic response of isolated, perfused afferent arterioles obtained from FHH andthe new FHH.1BN congenic strains E and F and performedexpression and sequence analysis on all the genes in the region.Finally, as the development of a myogenic response is criti-cally dependent on membrane potential and inhibition of theopening of large-conductance calcium-activated potassium(BK Ca ) channels, we performed patch-clamp studies to assessK  channel activity in vascular smooth muscle cells (VSMCs)isolated from renal arterioles obtained from FHH rats andFHH.1BN congenic strains. METHODS General Experiments were performed in  200 male FHH and FHH.1BNcongenic rats (9–21 wk old) bred and maintained at the Universityof Mississippi Medical Center, which is fully accredited by the Address for reprint requests and other correspondence: R. J. Roman, Dept.of Pharmacology and Toxicology, Univ. of Mississippi Medical Center, 2500North State St. Jackson, MS 39216 (e-mail: rroman@umc.edu).  Am J Physiol Renal Physiol  304: F565–F577, 2013.First published December 5, 2012; doi:10.1152/ajprenal.00404.2012.1931-857X/13 Copyright  ©  2013 the American Physiological Societyhttp://www.ajprenal.org F565   a t   U ni  v  of  Mi   s  s i   s  s i   p pi  M e d  C  en t   er  onM ar  c h 1  8  ,2  0 1  3 h  t   t   p:  /   /   a j   pr  en al  . ph  y  s i   ol   o g y . or  g /  D  ownl   o a d  e d f  r  om   American Association for Accreditation of Laboratory AnimalCare (AAALAC). All protocols were approved by the InstitutionalAnimal Care and Use Committee of the University of MississippiMedical Center. The rats had free access to food and water. Afterweaning, the rats were maintained on purified AIN-76 rodent dietcontaining 0.4% NaCl (Dyets, Bethlehem, PA). Protocol 1: Generation of Subcongenic Strains from FHH.1BN Congenic Strain C  In previous studies, we found that autoregulation of RBF is im-paired in FHH rats and transfer of a 4.7-Mb region of RNO1 from BNrats in a FHH.1BN double congenic, presented here as strain C in Fig.1, restored autoregulation (48). The goal of the present study was tocreate additional double subcongenic strains to narrow the region of interest further so that positional candidate genes could be prioritizedby sequencing and expression studies.Three male FHH.1BN congenic strain C rats were backcrossedwith six female rats from the FHH.1BN congenic strain A to generatean F1 generation, heterozygous for the region of interest and homozy-gous for BN alleles in the  RF-2  region and FHH alleles across theremainder of the genome. From this F1 colony, 18 breeding pairs wereset up to generate F2 rats. Each of the F2 animals was genotyped byPCR with a set of 30 polymorphic microsatellite markers equallyspaced across the 4.7-Mbp region of interest. The genetic distanceacross the srcinal region was 4.7 Mbp, which corresponds to a 5%recombinant frequency, and  700 F2 rats were genotyped to identifythe founders for the two new subcongenic lines. The heterozygousfounders were backcrossed to FHH.1BN control congenic line A toretain the 99.4-Mbp BN region on RNO1, and the heterozygousprogeny were intercrossed to obtain homozygous animals for the twonew subcongenic strains D and E.After narrowing the region of interest by phenotyping strains D andE for autoregulation of RBF relative to the srcinal double congenicstrain C and a control FHH.1BN congenic strain A that retains thecommon 99.4-Mbp region (131.1–230.5 Mbp) of BN RNO1 encom-passing the  Rf-2  region including the Rab38 gene known to preventbleeding (8) and restore proximal tubular reabsorption of protein (32),we generated a minimal congenic strain to eliminate the possibilitythat gene-gene interactions are responsible for the restoration of theRBF autoregulation phenotype. This was accomplished by crossingFHH.1BN congenic strain E with FHH rats. The F1 heterozygous ratswere intercrossed, and the F2 population was genotyped to find pairsof animals that reverted to the FHH genotype in the 99.4-Mb  Rf-2 region but remained heterozygous for the BN genotype in the2.4-Mbp region of interest from 258.8 to 261.2 Mbp of RNO1.Pairs of these animals were intercrossed to generate the FHH.1BNstrain F. Genotyping.  Genomic DNA was isolated from a piece of tail orthe ear using a Direct PCR lysis reagent (Viagen 102-T) and thensubjected to PCR amplification using 5 = -fluorescent-labeled prim-ers. The PCR reactions were performed in a 10-  l volume andcontained 1   l 10   buffer, 100 nM forward and reverse primers,1.5 mM MgCl 2 , 250  M dNTPs, 25 nM Taq polymerase, and 20 ngof genomic DNA. The reactions were denatured at 94° C for 3 minand cycled 25 times at 94° C for 1 min, 55° C for 2 min, and 72°C for 3 min. The products were mixed with loading dye (1:1),denatured, loaded on sequencing gels, and read using an ABI 3700sequencer. GENES IN 2.4 Mbp REGION (15)  RGD1561333 Similar to 60S ribosomal protein-L8 • Soluble X-prolyl aminopeptidase 1 • MAX interactor 1 • Adducin 3 (gamma) • LOC 100360467 Max interator 1-like • LOC 100360898 Max interator 1-like • Survival motor neuron domain • LOC100360511 hypothetical protein • Dual specificity phosphatase 5 • LOC100360558 Ribosomal protein S12-like • Structural maintenance of chromosomes 3 • RNA binding motif protein 20 • Programmed cell death 4 • LOC100360174 Binding domain protein 3-like • Soc-2 (suppressor of clear) homolog - - + + - + + Rat Chromosome 1 0 0 12.9 4.7 2.3 2.4 2.4 q terminus BN Region (Mbp)  Autoregulation phenotype 0 Mb    R   f  -   1   R   f  -   2 41.1 Mb D1Rat 234   139.0 Mb D1Rat 210 158.5 Mb D1Rat 47 190.2 Mb D1Rat 287 242.8 Mb D1Rat 119 258.8 Mb D1Rat 09 131.1Mb D1Rat 183 230.5 Mb D1Rat76 224.5 Mb D1Rat 73 p terminus q  terminus FHH A B C D E F Position - Marker Fawn Hooded (FHH) region Brown Norway (BN) region 256.5 Mb D1Rat 376 261.2 Mb D1Rat 225 252.6 Mb D1Mgh13 Fig. 1. Genetic map of regions of Brown Norway (BN) chromosome 1 in FHH.1BN congenic strains. Fawn hooded hypertensive rat (FHH) regions are presentedin white, and BN regions are presented in black. The  left   side of the figure indicates some of the polymorphic markers used to genotype the strains. The limitsof the previously reported renal failure QTL regions,  Rf-1  and  Rf-2 , are highlighted in gray. Currently, there are 15 known and predicted genes in the 2.4-Mbpregion of interest. The official Rat Genome nomenclature for strains are as follows: strain A  FHH.1BN-(D1rat183-D1rat76), strain B  FHH.1BN-(D1rat183-D1rat76;D1Mgh13-D1Rat89), strain C  FHH.1BN-(D1rat183-D1rat76;D1Rat376-D1Rat225), strain D  FHH.1BN-(D1rat183-D1rat76;D1Rat376-D1Rat09),strain E  FHH.1BN-(D1rat183-D1rat76;D1Rat09-D1Rat225), strain F  FHH.1BN-(D1Rat09-D1Rat225). F566  IMPAIRED MR IN FHH  AJP-Renal Physiol  •  doi:10.1152/ajprenal.00404.2012  •  www.ajprenal.org   a t   U ni  v  of  Mi   s  s i   s  s i   p pi  M e d  C  en t   er  onM ar  c h 1  8  ,2  0 1  3 h  t   t   p:  /   /   a j   pr  en al  . ph  y  s i   ol   o g y . or  g /  D  ownl   o a d  e d f  r  om   Protocol 2: Autoregulation of RBF in FHH and FHH.1BN Congenic Strains These experiments were performed in 12-wk-old FHH rats and ratsfrom FHH.1BN congenic strains A, C, D, E, and F ( n  45). The ratswere anesthetized with ketamine (30 mg/kg; Phoenix Pharmaceutical,St. Joseph, MO) and Inactin (50 mg/kg; Sigma, St. Louis, MO), anda PE-240 cannula was placed in the trachea to facilitate breathing. Thefemoral artery and vein were cannulated for intravenous (iv) infusionsand measurement of arterial pressure, and a clamp was placed on theaorta above the left renal artery for control of renal perfusion pressure(RPP). A 2-mm ultrasonic Doppler flow probe (Transonic Systems,Ithaca, NY) was placed on the left renal artery to measure RBF. Therats received an iv infusion of 0.9% NaCl solution containing 2% BSAat a rate of 100  l/min to replace surgical fluid losses. After surgeryand a 30-min equilibration period, the rats were acutely volumeexpanded with a solution of 6% BSA in 0.9% NaCl at a dose of 1ml/100 g to inhibit tubuloglomerular feedback responsiveness. Theceliac and mesenteric arteries were then tied off to raise mean arterialpressure (MAP) to  150 mmHg, and RBF was measured as RPP waslowered from 140 to 60 mmHg in 10-mmHg increments by adjustingthe clamp on the aorta. Protocol 3: Time Course of Development of Hypertension,Proteinuria, and Glomerular Injury in FHH and FHH.1BN Congenic Strains These experiments were performed in 9- to 21-wk-old FHH,FHH.1BN control congenic strain A that did not autoregulate RBFand FHH.1BN congenic strains C, E, and F that did autoregulate RBF.Proteinuria was measured at 9, 12, 15, 18, and 21 wk using theBradford method and BSA as the standard (Bio-Rad Laboratories,Hercules, CA). At each time point, the rats were placed in metaboliccages overnight for determination of protein excretion. At 11 wk of age, some of the rats in each group were anesthetized with isofluraneand telemetry catheters (model TA11PAC40, Data Sciences Interna-tional, St. Paul, MN) were surgically implanted in the femoral arterywith transmitters placed under the skin. MAP was recorded between9 and 12 AM when the rats were 12, 15, 18, and 21 wk of age. At 21wk, the rats were anesthetized and the kidneys were flushed with 10ml of 0.9% NaCl via a cannula placed in the aorta. The kidneys werethen collected, weighed, and fixed in a 10% buffered formalin solu-tion. Paraffin sections were cut (3   m) and stained with Masson’strichrome to determine the degree of glomerular injury and renalinterstitial fibrosis. Images were captured using a Nikon Eclipse 55imicroscope with a Nikon DS-Fi1 color camera (Nikon, Melville, NY)and NIS-Elements D 3.0 software. The degree of glomerular damagewas assessed on 30–40 glomeruli/section as the percentage of theglomerular capillary area filled with matrix material on a 0–4 scale,with 0 representing no injury, 2 indicating loss of 50% of glomerularcapillary area, and 4 representing the complete obstruction of glomer-ular capillaries. Interstitial fibrosis was analyzed using NIS-Elementsautomated measurements software after thresholding for determina-tion of the percentage of the image stained blue. Protocol 4: Myogenic Response in Isolated Afferent Arterioles The myogenic response was measured in afferent arterioles micro-dissected from the kidneys of 8- to 10-wk-old FHH rats and FHH.1BNcongenic strains E and F. The rats were anesthetized with isoflurane,and the kidneys were removed and placed in ice-cold MEM (GIBCO,Grand Island, NY) containing 5% BSA. Superficial afferent arterioleswith an attached glomerulus were microdissected, transferred to atemperature-regulated chamber (37°C) mounted on an inverted mi-croscope (Eclipse Ti; Nikon, Melville, NY), and cannulated with glasspipettes. Afferent arterioles were perfused with MEM from the prox-imal end. The vessels were imaged using a digital CCD camera(CoolSnap Photometrics, Tucson, AZ), and the images were displayedand vessel diameters were determined using NIS-Elements imagingsoftware (Nikon). Perfusion pressure was set to 60 mmHg, and aftera 30-min equilibration period the baseline diameter of the vessel wasdetermined. Perfusion pressure was then increased to 120 mmHg, andafter 5 min the diameter of the vessel was redetermined. Additionalexperiments were performed in afferent arterioles isolated from FHHrats and FHH.1BN congenic strain F before and after removal of Ca 2  from the bath to determine the degree of myogenic tone. Experimentswere also performed in vessels isolated from FHH rats and FHH.1BNcongenic strains E and F before and after treatment with iberiotoxin(100 nM; Anaspec, Fremont, CA) to determine the influence of thelarge-conductance K  channel on the myogenic response. Protocol 5: Patch-Clamp Experiments These experiments were performed in VSMCs freshly isolatedfrom renal interlobular arteries microdissected from the kidneys of FHH rats and FHH.1BN congenic strains E and F. These vessels wereused as it is difficult to microdissect a sufficient number of afferentarterioles in a limited period of time to isolate VSMCs, and we havepreviously reported that the myogenic response is impaired in isolatedinterlobular arteries of FHH rats (43), thereby validating use of interlobular renal vessels as a source to isolate renal VSMCs forpatch-clamp experiments. The rats were anesthetized using isoflurane.The kidneys were removed, placed in ice-cold PBS, and renal inter-lobular arteries were microdissected. After dissection, the arterieswere digested in a dissociation solution containing 145 mM NaCl, 4mM KCl, 1 mM MgCl 2 , 10 mM HEPES, 0.05 mM CaCl 2 , and 10 mMglucose for 10 min at room temperature. The undigested vessels werepelleted at 1,000 rpm for 5 min, and the supernatant was removed. Thevessels were incubated in fresh dissociation solution also containingpapain (22.5 U/ml, Sigma) and dithiothreitol, 1 mg/ml, for 12 min at37°C and centrifuged at 1,000 RPM for 5 min. The supernatant wasremoved, and then the vessels were incubated in fresh dissociationsolution containing collagenase (250 U/ml; Sigma), trypsin inhibitor(10,000 U/ml), and elastase (2.4 U/ml) and incubated for 12 min at37°C. Single cells were released by gentle pipetting of the digestedtissue. The supernatant containing VSMCs was collected, and theVSMCs were pelleted by centrifugation. They were then resuspendedin fresh dissociation solution and held at 4°C until use in a patch-clamp experiment that was performed within 2–4 h after cell isolation. Whole cell patch-clamp experiments.  K  currents were recordedfrom VSMCs using a whole cell patch-clamp mode at room temperature.The bath solution contained (in mM) 130 NaCl, 5 KCl, 2 CaCl 2 , 1MgCl 2 , 10 HEPES, and 10 glucose (pH 7.4), and the pipettes were filledwith a solution containing (in mM) 130 K gluconate, 30 KCl, 10 NaCl,1.8 CaCl 2 , 1 MgCl 2 , and 10 HEPES (pH 7.4). The concentrations of EGTA and Ca 2  in the pipette solution were varied to obtain cytosolicfree Ca 2  concentrations of 0.1 or 1  M. The patch-clamp pipettes wereconstructed from 1.5-mm borosilicate glass capillaries using a two-stagemicropipette puller (model PC-87; Sutter Instruments, San Rafael, CA)and heat-polished using a microforge. The pipettes had tip resistances of 2–8 M  . The tip of a pipette was positioned on a cell, a 5- to 20-G  sealwas formed, and the membrane was ruptured by repeated gentle suctionwith a glass syringe. An Axopatch 200B amplifier (Axon Instruments,Foster City, CA) was used to clamp pipette potential and record wholecell currents. The amplifier output signals were filtered at 2 kHz using aneight-poleBesselfilter(FrequencyDevices,Haverhill,MA).Thecurrentswere digitized at a rate of 10 kHz and stored on the hard disk of acomputer for off-line analysis. Data acquisition and analysis were per-formed using Clampfit software (version 10.0, Axon Instruments). Out-wardcurrentswereelicitedby20-mVvoltagesteps(300-msduration,5-sintervals) from  60 to  120 mV from a holding potential of   40 mV.Peak current amplitudes were obtained by averaging 5–10 trials. Mem-brane capacitance was determined by integrating the average capacitancein response to a 5-mV pulse. Peak currents were expressed as currentdensity (pA/pF) to normalize for differences in the size of the VSMCs. In F567 IMPAIRED MR IN FHH  AJP-Renal Physiol  •  doi:10.1152/ajprenal.00404.2012  •  www.ajprenal.org   a t   U ni  v  of  Mi   s  s i   s  s i   p pi  M e d  C  en t   er  onM ar  c h 1  8  ,2  0 1  3 h  t   t   p:  /   /   a j   pr  en al  . ph  y  s i   ol   o g y . or  g /  D  ownl   o a d  e d f  r  om   some experiments, the pipette tips were loaded with a control pipettesolution and then back-filled with solution containing 300 nmol/l iberio-toxin (Anaspec) so that the BK Ca  current could be measured before andafter blockade of the large-conductance BK Ca  channel. Single-channel experiments.  Single-channel BK Ca  currents wererecorded from VSMCs using inside-out patch-clamp mode at roomtemperature. The bath solution contained (in mM) 145 KCl, 0.37CaCl 2 , 1.1 MgCl 2 , and 10 HEPES (pH 7.4). The pipettes were filledwith a solution containing (in mM) 145 KCl, 1.8 CaCl 2 , 1.1 MgCl 2 ,and 5 HEPES (pH 7.4). Free cytosolic Ca 2  concentrations wereadjusted to 0.1 or 1  M. The pipettes had a tip resistance of 8–10 M  .After positioning of the pipette top on the surface of a cell, a G  seal(5–20 G  ) was formed by applying light suction. The inside-out patchconfiguration was achieved by rupturing the membrane with a suddenupward movement of the pipette. An Axopatch 200B amplifier (AxonInstruments) was used to clamp pipette potential and record single-channel currents. Data acquisition and analysis were performed usingpCLAMP software (version 7.02, Axon Instruments). Open-stateprobability (  NP o ) for single-channel currents, expressed as a percent-age of the total recording time in which a channel was open, wascalculated using the equation  NP o  (  Tj   j )/  T;  where  Tj  is the sumof the open time at a given conductance level,  j  represents multiplesof a given conductance, and  T   is the total recording time. Single-channel current recordings at membrane potentials between  60 and  80 mV and at [Ca 2  ] i  of 0.1 or 1  M were used to calculate  NP o . Protocol 6: Sequencing and Expression Analysis of Genes in the2.4-Mb Candidate Region Sequencing of FHH/EurMcwi genomic DNA was performed usingan Illumina HiSeq 2000. Sequence reads were aligned to the BNreference genome and single nucleotide variants (SNVs) were calledusing the CASAVA v1.8.1 program (Illumina, San Diego, CA). Thepotential functional consequences of variants identified by 10 or morereads with a variant frequency of   40% were predicted with EnsemblVariant Effect Predictor v2.2 1 . Predicted nonsynonymous variantswere further analyzed using the Polyphen program (31) to predict thefunctional consequence to the protein. To confirm that the predictedsequence variants were also captured in the FHH rats and FHH.1BNcongenic strains in our colonies, two of the functionally interestingpositional candidate genes in the region (  Dusp5  and  Add3 ) wereresequenced by Sanger sequencing as described before (35). PCRprimers were designed to amplify all the exons and introns across thecoding regions of these genes from genomic DNA. The primersincluded M13 tails that allow for direct sequencing of the productsusing a big dye terminator cycle sequencing kit and an ABI model3730 automatic sequencer (Applied Biosystems, Foster City, CA).The sequence files were transferred to a UNIX workstation, and basecalling sequence assembly and polymorphism detection were per-formed using a variety of sequence analysis programs, i.e., PHRED,PHRAP, CONSED, and POLYPHRED, looking for stop codons,splice variants, altered start sites, frame shifts, and/or major aminoacid substitutions that could alter the function of these proteins.Quantitative PCR (Q-PCR) assays were also performed to deter-mine whether any of the genes in this region are differentiallyexpressed in renal microvessels. Renal microvessels were bulk-iso-lated from the kidneys of 10-wk-old FHH rats and FHH.1BN con-genic strain F (6 rats/group) using a previously described sievingmethod (6, 49). The rats were anesthetized with isoflurane. A midlineabdominal incision was made, and the abdominal aorta was cannu-lated. The kidneys were flushed with 5 ml of an ice-cold physiologicalsalt solution followed by 5 ml of a 1% solution of Evans blue to aidin visualizing vessels. The kidneys were removed, and the renal cortexwas isolated and pushed through a 150-  m sieve that was autoclavedand treated with RNAlater. Glomeruli and tubules passed through thesieve, leaving intact vascular trees on the screen for collection. Wehave previously reported that this method for isolation of renalmicrovessels is very effective at removing glomeruli and tubules, andthe vascular preparation is   95% pure with some contamination byadherent proximal tubules. The resulting microvessel preparation wascollected in RNAlater and examined under a stereomicroscope for anyremaining tubular tissue, which was removed by microdissectionbefore placing of the vessels in TRIzol to isolate the RNA. Wepreviously reported that the residual contamination of bulk isolatedmicrovessels by tubules after microdissection as assessed by measur-ing expression of the proximal tubular markers,   -glutamyl trans-ferase, and alkaline phosphatase is negligible (49).After isolation, the vessels were homogenized using a ground-glasstissuehomogenizerin250  lTRIzol(Invitrogen),andRNAwasisolated.The RNA concentration of the samples was determined using a Synergy2 plate reader (BioTek, Winooski, VT), and the concentration wasadjusted to 1,000 ng/   l. RNA quality was evaluated using the Experionsystem (Bio-Rad). RNA was converted to cDNA using an iScript cDNAsynthesis kit (Bio-Rad) using 1   g of input RNA in a 20-  l reversetranscription reaction. Q-PCR reactions were performed using a CFX96Real-Time System C1000 Thermal Cycle (Bio-Rad) and normalized tothe expression of   -actin. The primers used to amplify the various genesin the region are presented in Table 1. Q-PCR contained Fast SYBRGreen Master mix (Thermo Scientific), 0.25 ng of the forward/reverse Table 1.  Forward and reverse primers used in quantitative PCR experiments to compare the expression of genes in renalvessels of the 2.4-Mbp region of interest in FHH/EurMcwi2 vs. BN rats Genes in the 2.4-Mbp Region Forward Primer Reverse Primer RGD1561333 Similar to 60S ribosomal L8  gtgggcaccatgcctgaggg tcaattctgcccccgccagc Soluble X-prolylaminopeptidase 1  actacgcgccgatccctgaga gccgtgtcctgttccgtgca MAX interactor 1  cgtctgtggcgcctcctgtc gcgcaggtgagctcgtcgatt Adducin 3 (gamma)  gcagccaagcggtgatcac gccatgatgtagtcggcgatctgc LOC100360467 Max interator 1-like  cgcagggagcgagagtgtga ctgtgcccggctcaacctcc LOC100360898 Max interator 1-like  aagtggaggccttcgtgccg gcgcaggtgagctcgtctcaa Survival motor neuron domain  cgaccgaatctcgtcgtggtgg tcctctgacatcttgggtgggact LOC100360511 Hypothetical protein  agccccgcaccctcacagag ggcctagtcgggcctcaggg Dual-specificity phosphatase 5  cgtgctggaccagggcagccg gag aatgggctttccgcactg LOC100360558 Ribosomal S12-like  ggccgaggaaggcatagctgc gccatcgtggatgagggcgg Structural maintenance of chromosome 3  cgcgctgttgcggttctgag cgaggacctgtaccctcgtgc RNA binding motif protein 20  ggcccccgagggtaccaagt gtcccagcctcattctctgccc Programmed cell death 4  gcccgtgttggcagtgtcct gcccaccaactgtggtgctct LOC100360174 Binding domain 3-like  gagaagggggagacactgtgcca tcccccagtctgcgccgtaa Soc-2 (suppressor of clear) homolog  ccctgccgagatcggtgaact agctcctcaagtgcgctgcat  -Actin  ctatgttgccctagacttcgagc gatagagccaccaatccacacag BN, Brown Norway rats. F568  IMPAIRED MR IN FHH  AJP-Renal Physiol  •  doi:10.1152/ajprenal.00404.2012  •  www.ajprenal.org   a t   U ni  v  of  Mi   s  s i   s  s i   p pi  M e d  C  en t   er  onM ar  c h 1  8  ,2  0 1  3 h  t   t   p:  /   /   a j   pr  en al  . ph  y  s i   ol   o g y . or  g /  D  ownl   o a d  e d f  r  om 
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x