Medicine, Science & Technology

Expression and regulation of the novel vascular endothelial growth factor receptor neuropilin-1 by epidermal growth factor in human pancreatic carcinoma

Description
Expression and regulation of the novel vascular endothelial growth factor receptor neuropilin-1 by epidermal growth factor in human pancreatic carcinoma
Published
of 10
7
Published
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Transcript
  Expression and Regulation of the Novel VascularEndothelial Growth Factor Receptor Neuropilin-1 byEpidermal Growth Factor in Human PancreaticCarcinoma Alexander A. Parikh,  M.D. 1 Wen Biao Liu,  M.D. 2 Fan Fan,  M.S. 2 Oliver Stoeltzing,  M.D. 2 Niels Reinmuth,  M.D. 2 Christiane J. Bruns,  M.D. 2 Corazon D. Bucana,  Ph.D. 2 Douglas B. Evans,  M.D. 1 Lee M. Ellis,  M.D. 1,2 1 Department of Surgical Oncology, The Universityof Texas M. D. Anderson Cancer Center, Houston,Texas. 2 Department of Cancer Biology, The University ofTexas M. D. Anderson Cancer Center, Houston,Texas.Supported in part by National Institutes of HealthGrant T-32 09599 (Alexander A. Parikh, M.D.), bythe Lustgarten Foundation (Lee M. Ellis, M.D.), andby the Lockton Fund for Pancreatic Cancer Re-search (Douglas B. Evans, M.D.).The authors thank Donna Reynolds for assistancewith immunohistochemistry; Guido Sclabas, M.D.,for assistance with obtaining human pancreaticspecimens; and Christine Wogan from M. D. Anderson’s Department of Scientific Publicationsfor editorial assistance. Address for reprints: Lee M. Ellis, M.D., Depart-ment of Surgical Oncology, Box 444, The Univer-sity of Texas M. D. Anderson Cancer Center, 1515Holcombe Boulevard, Houston, TX 77030-4009;Fax: (713) 792-4689; E-mail lellis@mdanderson.orgReceived December 9, 2002; revision receivedMarch 18, 2003; accepted May 5, 2003. BACKGROUND.  It was recently shown that neuropilin-1 (NRP-1), which was de-scribed srcinally as a receptor for the semaphorins/collapsins (ligands involved inneuronal guidance), is a coreceptor for vascular endothelial growth factor (VEGF)and increases the affinity of specific isoforms of VEGF to its receptor, VEGF-R2. METHODS.  The authors investigated the expression and regulation of NRP-1 inhuman pancreatic adenocarcinoma specimens and cell lines. RESULTS.  Immunohistochemical analysis revealed that NRP-1 was expressed in 12of 12 human pancreatic adenocarcinoma specimens but was absent in nonmalig-nant pancreatic tissue. Northern blot analysis revealed NRP-1 mRNA expression in8 of 11 human pancreatic adenocarcinoma cell lines. NRP-1 mRNA expression wasincreased by epidermal growth factor (EGF) but not by tumor necrosis factor    inseveral of the human pancreatic adenocarcinoma cell lines studied. Treating human Panc-48 adenocarcinoma cells with EGF activated Akt and Erk but not P-38.Blockade of the phosphatidylinositol-3 kinase (PI-3K)/Akt, mitogen-activated pro-tein kinase (MAPK)/Erk, or P-38 pathways abrogated EGF-induced NRP-1 expres-sion. Finally, EGF receptor blockade in vivo led to a decrease in NRP-1 expressionin an orthotopic model of human pancreatic carcinoma. CONCLUSIONS.  NRP-1 is expressed in most human pancreatic adenocarcinomasand cell lines but not in nonmalignant pancreatic tissue. EGF regulates NRP-1expression through the PI-3K/Akt and MAPK/Erk signaling pathways, and block-ade of the EGF receptor is associated with decreased expression of NRP-1 in vivo.NRP-1 may act as a coreceptor for VEGF in pancreatic carcinoma, as it does inother tumor systems, thereby enhancing angiogenesis and the effect of VEGF onthe growth of pancreatic adenocarcinoma.  Cancer   2003;98:720–9. © 2003 American Cancer Society. KEYWORDS: angiogenesis, pancreatic carcinoma, neuropilin-1 (NRP-1), epidermalgrowth factor (EGF), vascular endothelial growth factor (VEGF). V ascular endothelial growth factor (VEGF), or vascular permeability factor, is the best characterized of the angiogenic factors. VEGFhas been associated with increased angiogenesis and poor prognosisin patients with a variety of solid tumor types, including pancreaticcarcinoma. 1,2 Members of the VEGF family mediate both vascularpermeability and endothelial cell proliferation through three tyrosinekinase receptors: VEGF receptor 1 (VEGFR-1; Flt-1), VEGFR-2 (Flk-1/KDR), and VEGFR-3 (Flt-4). 3  Although it was believed initially that VEGF affected only endothelial cells, recent evidence suggests that VEGF receptors may also be present on tumor cells. 4,5 720 © 2003 American Cancer SocietyDOI 10.1002/cncr.11560  Neuropilin-1 (NRP-1) was srcinally characterizedas a receptor for semaphorins or collapsins, proteinsinvolved in the development of the nervous system. 6 Unlike the VEGF tyrosine kinase receptors, however,NRP-1 seems to be VEGF isoform specific and acts asa coreceptor for VEGF. It has been shown that NRP-1binds the VEGF isoform VEGF 165  as well as other fam-ily members, such as VEGF-B, VEGF-E, and placentalgrowth factor-2 (PGF-2). 7–9  Although it was foundsrcinally that NRP-1 was expressed on endothelialcells, expression of NRP-1 has been described recently in prostate, breast, and melanoma cell lines and inseveral tumors in vivo. 10–13 However, the expression of NRP-1 in gastrointestinal malignancies, including pancreatic adenocarcinoma, has not been character-ized; and the regulation and control of NRP-1 expres-sion in tumors have not been studied well. In thisstudy, we assessed whether NRP-1 was expressed inhuman pancreatic adenocarcinoma tissue and/or inuninvolved human pancreatic tissue. We also investi-gated the cytokines and intracellular signal-transduc-tion pathways that regulate NRP-1 expression in hu-man pancreatic adenocarcinoma cell lines. MATERIALS AND METHODS Tissue Specimens Human pancreatic adenocarcinoma and normal pan-creatic specimens that were obtained from consenting patients at The University of Texas M. D. AndersonCancer Center (M. D. Anderson) were frozen immedi-ately after resection in optimal cutting temperature(OCT) solution (Miles Inc., Elkhart, IN) and stored at   80 °C. Histopathologic diagnoses of pancreatic ad-enocarcinoma or normal pancreas were confirmed by the Department of Pathology at M. D. Anderson. Noneof the patients had received preoperative chemother-apy or radiation therapy. Reagents and Chemicals Recombinant human epidermal growth factor (EGF)and tumor necrosis factor    (TNF-  ) were purchasedfrom R&D Systems, Inc. (Minneapolis, MN). The anti-human EGF receptor (EGFR) monoclonal antibody C225 was kindly provided by Dan Hicklin (ImCloneSystems, New York, NY). The mitogen-activated pro-tein kinase (MAPK)/extracellular signal-regulated ki-nase (MEK)-1/2 inhibitor U0126 and the MEK1 inhib-itor PD98059 were obtained from New EnglandBiolabs Inc. (Beverly, MA). The phosphatidylinositol-3kinase (PI-3K) inhibitor Wortmannin was purchasedfrom Sigma Chemical Company (St. Louis, MO). TheP-38 MAPK inhibitor SB203580 was purchased fromCalbiochem (San Diego, CA). Cell Lines The human pancreatic adenocarcinoma cell linesPanc-1, CFPAC, ASPC-1, HS766T, HPAF-2, BX-PC3,and MIAPACA-2 were obtained from the AmericanTypeCulture Collection (ATCC; Manassas, VA). Thehuman pancreatic adenocarcinoma cell lines SG, FG,and L3.6pL were generous gifts of I. J. Fidler, D.V.M.,Ph.D., of M. D. Anderson and were derived from COLO357 cells, as described previously. 14 The human pan-creatic adenocarcinoma cell line Panc-48 was a gen-erous gift of D. McConkey, Ph.D., of M. D. Anderson.Cell lines were cultured and maintained in minimalessential medium supplemented with 10% fetal bo-vine serum (FBS), 2 units/mL penicillin-streptomycin,vitamins, 1 mM sodium pyruvate, 2 mM L-glutamine,and nonessential amino acids at 37 °C in 5% CO 2  and95% air. Immunofluorescent Staining for NRP-1 and Cytokeratin-22 in Frozen Tissue Specimens Tissue specimens frozen in OCT were sectioned (8–10  m thick), mounted on positively charged Superfrostslides (Fisher Scientific, Houston, TX), and air driedfor 30 minutes. Snap-frozen tissues were fixed in coldacetone (5 minutes), followed by 1:1 acetone:chloro-form (5 minutes) and acetone (5 minutes), then washed with phosphate-buffered saline (PBS) 3 timesfor 3 minutes each. All samples were incubated with3% hydrogen peroxide in methanol for 12 minutes atroom temperature to block endogenous peroxidase.Sections were then washed 3 times for 3 minutes each with PBS, pH 7.5, then incubated for 20 minutes atroom temperature in a protein-blocking solution con-sisting of PBS supplemented with 1% normal goatserum and 5% normal horse serum. The primary anti-bodies directed against NRP-1, polyclonal rabbit anti-NRP-1 at 1:100 dilution (Santa Cruz Biotechnologies,Santa Cruz, CA) or undiluted cytokeratin-22 (CK-22)(Fisher Scientific), were applied to the sections andincubated overnight at 4 °C. Sections were then rinsed3 times for 3 minutes each in PBS and incubated for 10minutes in protein-blocking solution. In a darkenedroom, the blocking solution was drained, and the sam-ples were incubated with the fluorescein-conjugatedsecondary antibodies Alexa 594 goat antirabbit immu-noglobulin G (IgG; CK-22; 1:400 dilution) (MolecularProbes, Eugene, OR) and Alexa 488 goat antimouseNRP-1 (1:400 dilution) (Molecular Probes) for 1 hourat room temperature; care was taken to avoid lightexposure during the incubation. Samples were then washed 3 times with PBS and mounted with 4,6-dia-midino-2-phenylindole fluorescent mounting media Neuropilin-1 in Pancreatic Carcinoma/Parikh et al. 721  (Vector Laboratories, Burlingame, CA). Immunofluo-rescence microscopy was performed with a  100–200objective on an epifluorescence microscope equipped with narrow-band-pass excitation filters mounted in afilter wheel (Chroma Technology Corporation, Brattle-boro, VT) to individually select for green, red, and bluefluorescence. Images were captured with aHamamatsu C5810 camera (Hamamatsu PhotonicsK.K., Bridgewater, NJ) mounted on a Zeiss universalmicroscope (Carl Zeiss Inc., Thornwood, NY) using Optimas image-analysis software (Media Cybernetics,Silver Spring, MD) installed on a Pentium chip Com-paq computer. Unaltered images were transferred to Adobe Photoshop (Adobe Systems, Mountain View,CA) for viewing and processing. The presence of CK-22(epithelial cells) was identified by red fluorescence,and NRP-1 expression was detected by green fluores-cence. The protocol for control specimens was similarexcept that the primary antibody was omitted. Immunoperoxidase Staining for NRP-1 in Frozen TissueSpecimens Frozen specimens of normal pancreatic tissue andpancreatic adenocarcinoma were fixed and incubated with a primary NRP-1 antibody (polyclonal rabbitanti-NRP-1; 1:150 dilution; Santa Cruz Biotechnolo-gies) overnight, as described earlier. The secondary antibody (peroxidase-conjugated goat antirabbit IgG[H  L]; Jackson Research Laboratories, Westgrove, PA) was then used at a 1:400 dilution. Sections were washed 3 times with PBS, rinsed with PBS and 0.1%Brij35 detergent, and incubated with stable diamino-benzidine substrate (Research Genetics, Huntsville, AL); during that incubation, the staining was moni-tored by brightfield microscopy. The reaction washalted by rinsing with double-distilled H 2 O. The sec-tions were counterstained with Gill no. 3 hematoxylinsolution (Sigma Chemical Company), mounted withUniversal Mount (Research Genetics), and analyzedby light microscopy. The protocol for control speci-mens was similar except that the primary antibody  was omitted. The Effects of EGF and TNF-   on the Expression of NRP-1 mRNA in Panc-48, Panc-1, and HPAF-2 Cells To determine the effects of EGF and TNF-   on NRP-1mRNA expression, Panc-48, Panc-1, and HPAF-2 cells were grown to subconfluence in standard medium, asdescribed earlier, and the medium was changed tomedium containing 5% FBS overnight. Cells were thenincubated with EGF (100 ng/mL) or TNF-   (10–20ng/mL) for 4–24 hours in medium containing 1% FBS.Total RNA was extracted, and NRP-1 mRNA expres-sion was determined by Northern blot analysis. The Effect of Increasing Doses of EGF on NRP-1 mRNAExpression in Panc-48 Cells To determine the effect of increasing doses of EGF onNRP-1 mRNA expression, Panc-48 cells were grown tosubconfluence in standard medium, as described ear-lier, and the medium was changed to medium con-taining 5% FBS overnight. Cells were then incubated with EGF (0–250 ng/mL) for 24 hours in mediumcontaining 1% FBS. Total RNA was extracted, andNRP-1 mRNA expression was determined by Northernblot analysis. The Effect of EGF on Erk-1/2, Akt, and P-38Phosphorylation in Panc-48 Cells To determine the effect of EGF on the protein levelsand phosphorylation status of the signaling interme-diates Erk-1/2, Akt, and P-38 MAPK, Panc-48 cellsgrown under the conditions described earlier wereincubated with EGF (100 ng/mL) for 0 minutes, 10minutes, 15 minutes, 30 minutes, or 60 minutes inmedium containing 1% FBS and then lysed. Phos-phorylated and total protein levels were determinedby Western blot analyses. The Effect of Inhibiting Erk-1/2, Akt, and P-38 MAPK onNRP-1 Induction by EGF To determine the effect of inhibiting Erk-1/2, Akt, andP-38 MAPK on NRP-1 induction, Panc-48 cells grownunder the conditions described earlier were treated with 50   M PD98059 (MEK1 inhibitor), 10   M U0126(MEK-1/2 inhibitor), 200 nM Wortmannin (PI-3K in-hibitor), or 25   M SB203580 (P-38 MAPK inhibitor) for1 hour in medium containing 1% FBS, followed by theaddition of EGF (100 ng/mL) or medium containing 1% FBS alone, as a control, for 24 hours. Total RNA  was extracted, and Northern blot analysis was per-formed. RNA Extraction and Northern Blot Analysis Total RNA was harvested from subconfluent tumorcells in culture with the TRIZOL Reagent (Gibco-BRL,Grand Island, NY) according to the manufacturer’sinstructions. Northern blot analysis was performed asdescribed previously. 15 Briefly, 25   g of RNA werefractionated on 1% denaturing formaldehyde-agarosegels and transferred to a Hybond-N   positively charged nylon membrane (Amersham Life Science, Arlington Heights, IL) overnight by capillary elution. After ultraviolet (UV) cross-linking at 120,000 mJ/cm 2  with a UV Stratalinker 1800 (Stratagene, La Jolla, CA),the membranes were prehybridized at 65 °C for 3–4hours in rapid hybridization buffer (Amersham LifeScience). The membranes were then hybridized at 722 CANCER August 15, 2003 / Volume 98 / Number 4  65 °C overnight with the cDNA probe for NRP-1 or glyc-eraldehyde 3-phosphate dehydrogenase (GAPDH). Theprobed membranes were then washed, and autoradiog-raphy was performed. The cDNA probes used were ahuman NRP-1 450 base pair cDNA probe derived fromthe reverse transcriptase-polymerase chain reactionproduct of PC-3 human prostate carcinoma cells (ATCC)using the primers (ACGATGAATGTGGCGATACT) 3  -5  and (AGTGCATTCAAGGCTGTTGG) 5  -3   and using aGAPDH probe purchased from ATCC. Probes were pu-rified by agarose gel electrophoresis with the QIAEX gel-extraction kit (QIAGEN Inc., Chatsworth, CA). EachcDNA probe was radiolabeled with [  - 32 P]deoxyribo-nucleotide triphosphate using the random-priming technique with the Rediprime labeling system (Amer-sham Life Science). Western Blot Hybridization Cells were rinsed twice with ice-cold PBS and lysed with protein lysis buffer (20 mM sodium phosphate,pH 7.4; 150 mM NaCl; 1% Triton X-100; 5 mM eth- ylenediamine tetraacetic acid; 5 mM phenylmethyl-sulfonyl fluoride; 1% aprotinin; 1   g/mL leupeptin;and 500   M Na 3  VO 4 ). Aliquots (50   g) of protein were subjected to electrophoresis on 8% polyacryl-amide gels followed by electrotransfer to nitrocellu-lose membranes (Schleicher & Schleicher, Keene,NH). Membranes were blocked with 5% fat-free milk in 0.1% Tween-20 in PBS. The primary antibodiesused in this study were 1:1000 dilutions of rabbitpolyclonal antiphosphospecific p44/42 MAPK (Erk-1/2) antibody, antitotal Erk antibody, antiphos-phospecific P-38 MAPK antibody, anti-P-38 MAPK antibody, antiphosphospecific Akt antibody, antito-tal Akt antibody, and anti-  -actin antibody (all fromNew England Biolabs, Beverly, MA). The mem-branes were then washed and treated with the sec-ondary antibody labeled with horseradish peroxi-dase (antirabbit immunoglobulin from donkey at1:3000 dilution; Amersham Life Science). Proteinbands were visualized by using a commercially available chemoluminescence kit (Amersham LifeScience). Before reprobing, the membranes were washed with stripping solution (100 mM 2-mercap-toethanol; 2% sodium dodecyl sulfate; and 62.5 mMTris-HCl, pH 6.7) for 30 minutes at 50 °C. Immunofluorescent Staining for NRP-1 in OrthotopicL3.6pL Tumors Tissues from a previous study  16  were used to analyzethe effect of EGFR inhibition on the expression of NRP-1 by orthotopic tumors. Briefly, L3.6pL humanpancreatic adenocarcinoma cells were injected intothe pancreas of male athymic mice. Seven days later,the mice were assigned randomly to undergo biweekly intraperitoneal injection of the chimeric anti-EGFRmonoclonal antibody C225 (1 mg/injection; ImCloneSystems) or saline (control), and tumors were har-vested on Day 11 and immediately frozen in OCTcompound. 16 For these experiments, tumors were sec-tioned and immunofluorescently stained for NRP-1 asdescribed above. RESULTS Immunohistochemical Staining of Human PancreaticAdenocarcinomas for NRP-1 To determine whether NRP-1 expression is present inhuman pancreatic adenocarcinoma and/or normal FIGURE 1.  Representative sections showing hematoxylin and eosin (H&E) staining and immunohistochemical staining for neuropilin-1 (NRP-1) expression inspecimens of nonmalignant human pancreas ( n   10 specimens) and in specimens of malignant human pancreatic adenocarcinoma ( n   12 specimens). Frozensections were stained, and representative images were obtained at a magnification of  100 (H&E; top row) or  200 (NRP-1; bottom row) by light microscopy.NRP-1 production is indicated by reddish-brown staining. Neuropilin-1 in Pancreatic Carcinoma/Parikh et al. 723  human pancreas, immunoperoxidase staining wasperformed on 12 specimens of frozen human pancre-atic adenocarcinoma and 10 specimens of frozen, un-involved, nonmalignant human pancreas. NRP-1 waspresent in all 12 specimens of histologically confirmedpancreatic adenocarcinoma but in none of the non-malignant pancreatic specimens (Fig. 1).To localize the srcin of the NRP-1 expressed,immunofluorescent staining was performed on the12 frozen specimens of human pancreatic adeno-carcinoma. The samples were immunostained forCK-22 (an epithelial cell marker), to identify thetumor epithelium, and for NRP-1 (double-staintechnique). NRP-1 expression was present in allpancreatic adenocarcinoma specimens and was lo-calized to the adenocarcinoma epithelium (Fig. 2). Northern Blot Analysis of NRP-1 mRNA in HumanPancreatic Adenocarcinoma Cell Lines Eleven human pancreatic adenocarcinoma cell lines were examined by Northern blotting for the expres-sion of NRP-1. Eight of 11 cell lines (73%) expresseddetectable, constitutive NRP-1 mRNA (Fig. 3) in vari-ous amounts. NRP-1 mRNA expression was greatest inthe CFPAC-1 cell line and least (no constitutive ex-pression detected) in the MiaPaca-2, HS766T, and FGcell lines. NRP-1 Induction by EGF in Human PancreaticAdenocarcinoma Cells It was recently shown that the cytokines EGF andTNF-   induce NRP-1 expression in endothelial cellsand astrocytoma cells, respectively. 17,18 To examinethe role of EGF and TNF-   in the regulation of NRP-1 in human pancreatic adenocarcinoma, wetreated Panc-48 cells with EGF or TNF-   and sub-sequently analyzed NRP-1 mRNA levels. EGF in-creased NRP-1 mRNA expression, with maximumexpression observed at 24 hours (Fig. 4A). In con-trast, incubation of Panc-48 cells with TNF-   did notincrease NRP-1 mRNA levels (Fig. 4A). These find-ings were confirmed in two additional human pan-creatic adenocarcinoma cell lines; NRP-1 mRNA ex-pression was increased in Panc-1 and HPAF-2 cellsin response to EGF, but not in response to TNF-  (Fig. 4B). Extending the period of incubation withTNF-   or increasing the dose to 20 ng/mL also failedto increase NRP-1 mRNA levels in all three cell lines(data not shown). NRP-1 Induction by EGF in Human Pancreatic Cells IsDose Dependent To determine the effects of different concentrationsof EGF on NRP-1 mRNA expression, we treatedPanc-48 cells with escalating doses of EGF (0–250ng/mL) for 24 hours and subsequently analyzedNRP-1 mRNA levels. NRP-1 expression levels in-creased with increasing concentrations of EGF, withmaximum mRNA levels present with an EGF dose of 100 ng/mL, as determined by densitometric analysis(Fig. 5). FIGURE 2.  Immunofluorescence analy-sis of neuropilin-1 (NRP-1) expression inspecimens of human pancreatic adeno-carcinoma. Frozen sections ( n   12 sec-tions) were stained by immunofluores-cence, and representative images wereobtained at  100 magnification. The ex-pression of the epithelial cell marker cyto-keratin-22 (CK-22) is indicated by thepresence of red staining, and NRP-1 pro-duction is indicated by the presence ofgreen staining. Coexpression of NRP-1and CK-22 is shown as yellow staining. FIGURE 3.  Neuropilin-1 (NRP-1) mRNA expression in human pancreaticadenocarcinoma cell lines. Cells were grown to 80% confluence. Total RNA was harvested and, Northern blot analysis was used to quantify NRP-1expression. GADPH: glyceraldehyde 3-phosphate dehydrogenase. 724 CANCER August 15, 2003 / Volume 98 / Number 4
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x