of 41

Evolutionary genetics of Newcastle disease virus

0 views41 pages

Download

All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
PATTI J. MILLER Evolutionary genetics of Newcastle disease virus AVIAN FORUM ASIA Chiba, Japan July 12-13, 2016 US Department of Agriculture, Agriculture Research Service, US National Poultry Research
PATTI J. MILLER Evolutionary genetics of Newcastle disease virus AVIAN FORUM ASIA Chiba, Japan July 12-13, 2016 US Department of Agriculture, Agriculture Research Service, US National Poultry Research Center, Southeast Poultry Research Laboratory, 934 College Station Road, Athens, GA 30605, USA Patti J. Miller, Kiril M. Dimitrov, Claudio L. Afonso Introduction Athens, GA Genotypes & Evolution Diagnostics & Vaccination Newcastle Disease Team Claudio Afonso, PhD: Lead ND Microbiologist Kiril Dimitrov, DVM, PhD: Visiting Scientist from Bulgaria Tim Olivier, MS: Biological Science Technician Dawn Williams-Coplin: Biological Science Technician Iryna Goraichuk, PhD: Post Doc from Ukraine Poonam Sharma, PhD: Post Doc from France Tonya Taylor, PhD: Post Doc from Clemson University Stivalis Cardenas Garcia, DVM, PhD: Post Doc Univ. of Georgia Valerie Marcano: PhD/DVM student UGA Andrea Ayala, MS: PhD student UGA Salmon Latif, DVM: PhD and Pathology Resident UGA Mahmoud Sabra, DVM: Visiting Scientist from Egypt Patti Miller, DVM, PhD: Veterinary Medical Officer David Suarez, DVM, PhD: Research Leader Exotic & Emerging Avian Viral Disease Research Unit Newcastle Disease (ND) 1 Highly contagious viral disease of most (if not all) types of birds Reported in more than 236 species of birds representing 27 of 29 orders Etiology: VIRULENT strains of Newcastle disease virus (NDV) OIE*: Infections poultry with virulent NDV (vndv)= ND NDV of low virulence found world wide in wild birds and poultry species. Some are used as ND vaccines. *OIE = Office International des Epizooties = World Organisation for Animal Health They coordinate, support and promote animal disease control; facilitate trade OUTBREAKS ND OUTBREAK DATA FROM OIE 2 Jan 2012-June 2013 JAN. to JUNE 2012 JULY to DEC JAN. to JUNE 2013 Newcastle disease WORLDWIDE 68 countries reporting outbreaks in domestic poultry ISRAEL- 58 (2012), 20 (2013) PAKISTAN- all months (2012), Jan- June (2013). INDONESIA-All administrative divisions (23): every month (Jan 12-June 13) For comparison: HPAI & LPAI data for the same reporting time: 17 countries reporting outbreaks in domestic poultry Human Infection with mortality ND OUTBREAK DATA FROM OIE 2014 Domestic Poultry January June Newcastle disease: 61 countries reporting ND outbreaks in domestic poultry July December HPAI & LPAI: same reporting time: 10 countries/hpai 8 countries/lpai 6 countries/both 2015: countries reporting (26) ND & (23) HPAI domestic birds (as of April 2016) 4 3 Le NP P M F HN L Tr 5 -Negative sense -Non-segmented -6 structural genes -pleomorphic -neutralizing Ab to HN & F ~17 nm -Single-stranded -RNA Newcastle disease virus Glycoproteins: Fusion ( ) &Hemagglutinin Neuraminidase ( ) The immune system of the host is able to see the F & HN and make antibodies (Abs) to neutralize the virus. Mast & Demeestere Diagnostic Pathology, Feb 2009 HN/F bind & fuse to host cells. Neutralizing Abs inhibit attachment and fusion. What are virulent NDV? 5 OIE:1) Intracerebral Pathogenicity Index (ICPI) 0.7 2) 3 multiple basic amino acids (R, K) positions of fusion cleavage site* & phenylalanine R Q R R F K Q K R F K R R R F *If cleavage site is not virulent, need to do ICPI R= Arginine, K = Lysine NDV is activated when the Fusion protein is cleaved Why is the cleavage site so important? Virulent strains with 3 basic amino acids in the F cleavage site are cleaved by proteases found throughout the body of the host, therefore, the virus is systemic. NDV of low virulence (e.g. vaccines) with 3 basic amino acids are cleaved by proteases that are found in the GIT & RT of the host, & therefore, the virus and lesions are mostly limited to these locations. 6 Genetic diversity of APMV-1 pre APMV-1 comprise a highly diverse group of viruses All NDV isolates belong to one serotype (APMV-1) Several genetic groups (lineages/genotypes) have been identified Simultaneous evolutionary changes Lineages vs. genotypes Late 1980s/early 1990s Broad criteria 2012, Diel 2014, Consortium LINEAGES GENOTYPE Genotype V Lineage 3 Genotype III Genotype IV Unclassified Lineage 6 Genotype II Genotype I Lineage 2 Lineage 1 Lineage 4 Genotype VI Lineage 7 Genotype VII Lineage 5 Adapted from Cattoli et al., Vet Microbiol. 142, p , 2012. Genotypes 8 class II: XVIII genotypes* *some sub-genotypes Post 2012:Genotypes based on strict criteria BOOTSTRAP is a computer-based technique for assessing the accuracy of almost any statistical estimate. Provides assessments of confidence for each clade of an observed tree, based on the proportion of bootstrap trees showing that same grouping. Virology 391, 2009, class I- one genotype Mean Inter-population evolutionary distance between previous NDV genetic groups (containing at least 4!) Complete NDV genome Complete NDV fusion Genotypes-average distances (nt) per site 10% w/bootstrap 60% Bootstrap- accuracy, confidence Genetic distances rely on multiple sequence alignments 9 Number of base substitutions/site = averaging all sequence base pairs between aligned sequences with 1,662 nucleotides:[standard error estimates w/500 bootstrap replicates] & maximum composite likelihood model. SNOECK J. Clin. Microbiol. 51(7) 2013, Sub-genotypes: a) tree topology!, b) bootstrap 60%, 3) mean evolutionary distances 0.03 & 0.1. (Infect., Gen., Evol. 12, 2012, ) & 4) specific residues (SNOECK, 2013) Distance is often defined as the fraction of mismatches at aligned positions, with gaps either ignored or counted as mismatches. Sub-genotypes: Ia, b; Va, b, c ; VIb, c, e, f, g; VIIb, d, e, f, g, h, i; XIIIa,b, XIVa, b; XVIIa, b; XVIIIa, b. * Require multiple sequence alignments as input (replicates) J. Clin. Micorbiol. 51(7) 2013, NDV Challenges: The Root of the Problem 10 V,VI V V V XVI VII VII XII XIV, XVII XVIII VII VI XIV, XVII, XVIII V, VI,VII VIIi XVII, XVIII VI, VIIi VIIi, XIII VI, VII,XIII VII VI,VII, VIII, IX,XII,XV II,III, IV IX, VIIi VIII VII V VI 11 VII XI More details Infect. Genet. Evol Apr; 39: doi: /j.meegid Courtesy of Dr. Stivalis Cardenas Garcia Four defined ND panzootics Indonesia/England; genotypes II, III, IV (now rare) s Middle East/Europe/Americas; genotype V; first associated w/psittacines, now poultry. USA 2002, cormorants Canada/USA , Mexico Rare outside of Americas; Croatia, Slovenia, Bulgaria, Korea s variant NDV from pigeons N. Africa & Middle East; 1980s ~worldwide and ongoing. Can infect poultry species s Asia; genotype VII Africa, Western Europe, South America (2008); chickens, geese, ducks; ongoing 5.? 2014 reported possible 5 th panzootic started 2010 Indonesia Israel/Pakistan (Turkey/Bulgaria); chickens, pheasants, parrot; genotype VIIi; ongoing Virus Genes (2014) 49:89 99 DOI 10.7/s Characterization of complete genome sequence of genotype VI and VII velogenic NDV from Japan. Dennis V. Umali, Hiroshi Ito, Kazutoshi Shirota, Hiromitsu Katoh, Toshihiro Ito. Chickens isolates 1969 VIc, 1987 VIc, 1999 VIIe XVII XIII XII VII VI V II 13 NDV Genotypes over decadesusing GenBank complete fusion genes Poultry Sci (2015) 94 (5) Atypical velogenic Newcastle disease in a commercial layer flock in Japan Dennis V. Umali, Hiroshi Ito, Kazutoshi Shirota,Toshihiro Ito, Hiromitsu Katoh. Chicken/2002 VIId Dr. Claudio Afonso NDV IS EVOLVING BUT HOW FAST? Herczeg et al. (2001) & Czeglédi et al. (2002) indicated that the expected nucleotide sequence change of NDV caused by natural evolution is estimated to be approximately 1% per decade (or 0.1% per year). Herczeg et al., Avian Pathol. 30: Miller et al., 2009 (Virology, 391:64-72) 14 Czeglédi et al., Epidemiol Infect. 129: Fusion gene Ramey et al., 2013 (Arch Virol. 158: ) Fusion gene (wild birds) Complete genome Courtesy of Dr. Kiril Dimitrov Virulent genotype II & IX look to be recent introductions, not undergoing natural evolution. Summary statistics Mean Standard error Median Effective sample size Fusion gene substitution rate estimated using relaxed lognormal molecular clock Genotype II virulent strains Genotype IX virulent strains 7.05 x x x x x x Important to select Sequences from GenBank carefully When doing analysis on Rate of change. Dimitrov, J Clin Micro, 2016 Does vaccination affect evolution? 16 Belize ND outbreak 2008 more related to older NDV Intensive NDV vaccination program began in 2002 Virulent NDV genotype VII- genetic drift & spread 17 F. Perozo 1 st reported VII Venezuela in 2012 from 2008 outbreak In Columbia as early as 2006 In both countries as recent as 2014 and 2015 Dr. Afonso 18 Peru/2008 outbreak -reported 2012 closely related to VII -more isolates China revealed new genotype XII -now know XII was in Peru as early as 2004 from GenBank submissions in January, as early as 2009 spread to Columbia Dr. Afonso Implications of NDV Evolutionary Dynamics V Diagnostic failures and difficulties for disease control VII New diagnostic tests needed VI III/IV II I IX 86 XI Diagnostic tests 20 Antibodies - past infection Without worldwide vaccination cannot tell infected from vaccinated Virus Isolation- SPF Grow virus, HA+, RNA, sequence, rapid assay Rapid diagnostic tests RT- PCR Real time RT-PCR Florigenic probes using Taqman polymerase Monitor accumulation amplicon in real time Also use SyBr-green Fast results 21 Matrix Gene Real Time RT-PCR Assay Conserved region needed- made to detect all (most) APMV1 Matrix gene Allows rapid detection from single RNA preparation But does not detect class I viruses (approximately 70% of viruses of wild birds) or a virulent NDV from Pakistan Mukteswar (class II genotype III from 1940s) J Clin Microbiol Apr;45(4): and May 2010,48 (5): The Matrix Test: Relationship with Phylogeny Genotype V (California) 22 This is not surprising! Vaccines Class I SEPRL L Gene Primer/Probe Development (Multiplex) 23 Alignment from 37 sequences Software used for initial selection Hand selection of a variety of primers with a single probe `````````````````````` Conserved region = Polymerase gene SEPRL Polymerase Test Can Detect Class I NDV 24 NDV Polymerase Matrix Isolate # Site Year Class FAM Cycles FAM Cycles AGWT AK 1998 I POS POS MC-110 FR 1977 I POS SUSP MA 2005 I POS POS NY 2005 I POS SUSP NJ 2005 I POS POS NY 2005 I POS SUSP NY 2005 I POS SUSP RI 2005 I POS 14.9 POS NJ 2005 I POS NY 2005 I POS NJ 2005 I POS NY 2005 I POS NJ 2005 I POS NJ 2005 I POS NJ 2005 I POS NY 2005 I POS SUSP NJ 2005 I POS HK 2005 I POS HK 2005 I POS HK 2005 I POS HK 2005 I POS HK 2005 I POS USA/B1-47 US 1947 II NEG 0 POS PT OH 1987 II POS POS MLD-86-ca5 OH 1986 II POS POS 14.2 The Fusion RT-PCR Test to Detect Virulent NDV 25 The problem: It does not detect Dove/Italy/2000 Development of a Real-Time Reverse-Transcription PCR for Detection of Newcastle Disease Virus RNA in Clinical Samples Journal of Clinical Microbiology, January 2004, 2001-AY Dove Italy was not alone! 26 A Large group of pigeon NDVs isolated worldwide had very similar sequences at the Fusion cleavage site 0.02 Detection with Pigeon-specific Probes (SEPRL) Using the Fusion Protein Real time RT-PCR primers 27 Accession Isolate description Matrix Standard Fusion Fusion Pigeonspecific EU Eurasian Collared Dove/US/TX2334/ EU Eurasian Collared Dove/US/TX3817/ EU Eurasian Collared Dove/US/TX6295/ EU Eurasian Collared Dove/US/TX6306/ EU Eurasian Collared Dove/US/TX6338/ EU Dove/US/TX-B2580/ EU Pigeon/US/RI166/ EU Pigeon/US/TX3377/ EU Pigeon/US/TX3503/ EU Eurasian Collared Dove/US/TX3908/ EU Eurasian Collared Dove/US/TX3988/ EU Mourning Dove/US/TX4048/ EU Eurasian Collared Dove/US/TX4078/ EU Pigeon/US/TX4142/ EU Eurasian Collared Dove/US/TX4156/ J Vet Diagn Invest Nov;18(6): and J Clin Microbiol Oct;46(10): The September 10, 2008 Outbreak in Cormorants from Five Minnesota lakes were confirmed to have virulent Newcastle disease, according to the Minnesota Department of Natural Resources (DNR) seagulls and cormorants in Maryland, 60 miles from Delmarva (Poultry Industry) were also infected with vndv. cormorant 28 Real Time PCR Detection (the Fusion Assay fails) Isolate Species Yr Matrix Fusion Sequence 02US072 Game Fowl TGAGGAAGGAGACAGAAACGC CC02 Cormorant TC...T Cormorant TA...A...T 442 Cormorant TA...RA...T Fusion Assay failed for genotype V vndv All together 6 cormorant isolates were negative on real time rt-pcr for fusion Importance of VI in SPF embryonating chicken eggs (embryo death) especially lack of HA Since 2002 cormorant vndv don t HA Molecular assays that rely on genome sequence must be tested will all new NDV strains to ensure the assays are still valid Assays may (will eventually?) need to be modified either primer(s) or probe or you can create a multiplex to detect a broad range of strains This could also affect your sequence results if you are using NDV specific primers 29 30 NEX GEN Sequencing Sequence hundreds of millions of short (35bp-bp) sequences in a single run! Few common platforms: 454, Solexa/Illumina or SOLiD (ABI) ~$1,500 one human genome in a week. Problem: the amount of data is enormous Bioinformatics necessary Detect many avian viruses or bacteria from one sample 30 samples in one run Run not just with RNA extracted from NDV infected fluids, but also working on sequencing directly from extracted swabs and from formalin fixed tissue samples 31 NDV Vaccines & Evolution B1 & LaSota~ live and inactivated vaccines are universally used in the poultry industry in the U.S. These current ND vaccine strains are phylogenetically similar to the NDV strains isolated in the 1940s-50s (class II, genotype II) They differ phylogenetically from recent outbreak viruses of ND isolated in U.S that are related to the virulent Mexican strains (class II, genotype V) Still all NDV belong to one serotype 32 How to control ND? 1. BIOSECURITY IS KEY -Shower into chicken facilities -Change shoes and clothes -Move from cleanest to dirtiest birds -Keep out wild birds -Secure sources of water, feed, vaccines -Do not spread ND infected litter 33 How to control ND? 2. VACCINATION While we may still see egg drops in wellvaccinated layers, & we still have to administer booster vaccinations every 3-4 weeks in areas with vndv, for the most part we can control morbidity & mortality. Vaccination Goal #1: Increase the amount of vndv vaccinated birds need to receive to become infected 34 e.g. For NDV strain CA/USA/2002, a non-vaccinated 5 week broiler might only require 10,000 virus particles to become infected. That same broiler vaccinated & with an HI antibody titer of 64 may now need 1,000,000 virus particles to be infected. * Well-vaccinated birds still become infected even if they do not have clinical signs of disease* NDV found later incidentally in a flock infected with IBV. Flock was well vaccinated for NDV no signs of disease. Vaccination Goal #2: Decrease the amount of vndv vaccinated birds will shed after being infected at least - fold (e.g. shedding 10,000 virions instead of 1,000,000 in 1ml of saliva). 35 ORAL SHEDDING-4 d PI with CA PREVENT MORE BIRDS FROM RECEIVING THE DOSE NEEDED TO BE INFECTED 36 Conclusions NDV will continue to evolve. Diagnostic assays must always be tested and retested with new NDV isolates. Biosecurity is critical no matter what vaccine you use to allow birds enough time to develop a proper immune response. No vaccine will work if immunosuppressive agents are present as co-infections. Careful with cold chain, preparation & administration of vaccines, especially when using spray or water. It is critical to use a proper dose and to check backtiters of vaccines. 85% sero-conversion for herd immunity is necessary. Acknowledgements Merial David Suarez and Claudio Afonso NDV Team Animal Caretakers Bill Gagnon Ronald Graham Keith Crawford Roger Brock James Doster Thank you! QUESTIONS?
Advertisement
MostRelated
View more
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks