Magazine

Cloning, sequence analysis, and purification of choline oxidase from Arthrobacter globiformis: a bacterial enzyme involved in osmotic stress tolerance

Description
Cloning, sequence analysis, and purification of choline oxidase from Arthrobacter globiformis: a bacterial enzyme involved in osmotic stress tolerance
Categories
Published
of 10
6
Categories
Published
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Transcript
  Cloning, sequence analysis, and purification of choline oxidasefrom  Arthrobacter globiformis : a bacterial enzyme involvedin osmotic stress tolerance q Fan Fan, a,1 Mahmoud Ghanem, b,1 and Giovanni Gadda a,b,c,* a Department of Biology, Georgia State University, Atlanta, GA 30302-4098, USA b Department of Chemistry, Georgia State University, Atlanta, GA 30302-4098, USA c The Center for Biotechnology and Drug Design, Georgia State University, Atlanta, GA 30302-4098, USA Received 24 September 2003, and in revised form 14 October 2003 Abstract Choline oxidase catalyzes the four-electron oxidation of choline to glycine betaine, one of a limited number of compounds thataccumulate to high levels in the cytoplasm of cells to prevent dehydration and plasmolysis in adverse hyperosmotic environments. Inthe present study, the highly GC rich  codA  gene encoding for choline oxidase was cloned from genomic DNA of   Arthrobacter globiformis  strain ATCC 8010 and expressed to high yields in  Escherichia coli   strain Rosetta(DE3)pLysS. The resulting enzyme waspurified to high levels in a single chromatographic step using DEAE-Sepharose, as shown by SDS–PAGE analysis. Denaturationand mass spectroscopic analyses showed that the covalent linkage between the FAD cofactor and the protein is preserved in re-combinant choline oxidase, consistent with protein flavinylation being a self-catalytic process. The enzyme was shown to be ahomodimer of 120,000Da by size-exclusion chromatography and to be active with both choline and betaine aldehyde as substrate.Sequencing analysis indicated that the nucleotide sequence of   codA  srcinally reported in GenBank contains seven flaws, resulting ina translated protein with a significantly altered amino acid sequence between position 298 and 410.   2003 Elsevier Inc. All rights reserved. Keywords:  Choline oxidase; FAD; Flavin; Glycine betaine; Choline; Osmoprotection; GMC oxidoreductases; Self-flavinylation Choline oxidase (E.C. 1.1.3.17) catalyzes the four-electron oxidation of choline to glycine betaine ( N  , N  , N  -trimethylglycine; betaine) via betaine aldehyde asintermediate. Molecular oxygen acts as primary electronacceptor in the reaction (Scheme 1) [1]. The enzyme is of importance because glycine betaine is one of a limitednumber of compatible solutes that accumulate to highlevels in the cytoplasm of cells to prevent dehydrationand plasmolysis in adverse hyperosmotic environments[2–6]. Regulation of intracellular osmolality to hyper-osmotic environments is also intimately connected to anumber of physiological responses, such as increasedheat and cold tolerance, as well as regulation of theinternal pH and ionic strength [7–12]. Hyperosmolarityis often encountered at human infection sites [13], wherecholine and its precursors are very abundant [14–16],and is a major environmental signal controlling the ex-pression of genes associated with cellular invasion andvirulence in a number of human pathogens [17–24]. Forthese reasons, the study of choline oxidase is of con-siderable interest both for genetically engineering waterand osmotic stress resistance in economically relevantcrop plants lacking efficient glycine betaine biosyntheticsystems [10,11,25–29], and for the potential developmentof therapeutic agents that inhibit the biosynthesis of glycine betaine thereby making bacteria more suscepti-ble to conventional treatments.Choline oxidase has been purified from  Cylindrocar- pon didymum  M-1 [30],  Alcaligenes  sp. [31], and  Arthro-bacter globiformis  [1]. Based on amino acid sequencecomparisons, the enzyme can be grouped in theGMC oxidoreductase enzyme superfamily [32], which q Data deposition: the sequence reported in this paper has beendeposited in the GenBank database (Accession No. AY304485). * Corresponding author. Fax: 1-404-651-1416. E-mail address:  ggadda@gsu.edu (G. Gadda). 1 These authors contributed equally to this study.0003-9861/$ - see front matter    2003 Elsevier Inc. All rights reserved.doi:10.1016/j.abb.2003.10.003Archives of Biochemistry and Biophysics 421 (2004) 149–158  ABB www.elsevier.com/locate/yabbi  comprises enzymes like glucose oxidase, cholesterol ox-idase, or cellobiose dehydrogenase, that utilize FAD ascofactor for catalysis and non-activated primary alco-hols as substrate. Despite a wealth of studies on thebiotechnological applications of the enzyme, minimalbiochemical and mechanistic investigations of cholineoxidase have been reported to date. In this respect, ourgroup has recently reported the analyses of the steadystate kinetic mechanism and of the pH and deuteriumkinetic isotope effects on the oxidation of choline to be-taine aldehyde catalyzed by choline oxidase from  A. globiformis  [33,34]. One of the most critical impedimentsto future studies is the obtainment of large quantities of choline oxidase for detailed biophysical, mechanistic,and structural investigations. In the present study, wehave cloned from  A. globiformis  genomic DNA the  codA gene encoding for choline oxidase and heterologouslyexpresseditin Escherichiacoli  .Theresultingrecombinantenzyme has been purified to homogeneity in a singlechromatographic step and characterized for its flavincontent, catalytic activity, and oligomerization state. Materials and methods MaterialsEscherichia coli   strain JM109 harboring plasmidpGAH/ codA  was a kind gift from Dr. Murata, NationalInstitute for Basic Biology, Okazaki, Japan [27,28]. Afreeze-dried culture of   A. globiformis  (ATCC 8010) wasobtained from American Type Culture Collection. Re-striction endonucleases  Nde I and  Eco RI, calf intestinalalkaline phosphatase, T4 DNA ligase,  Taq  DNA poly-merase, deoxynucleotide triphosphates, and bovine se-rum albumin were purchased from Promega.  Pfu  DNApolymerase was obtained from Stratagene or RocheMolecular Biomedicals. Luria–Bertani agar, Luria– Bertani broth, chloramphenicol, tetracycline, kana-mycin, isopropyl- b - DD -thiogalactopyranoside (IPTG), 2 lysozyme, phenylmethylsulfonyl fluoride (PMSF), andbetaine aldehyde bromide were obtained from Sigma-Aldrich. Carbenicillin, ampicillin, choline chloride, andelectrophoresis-grade agar were purchased from ICNBiomedicals. Nutrient Broth and Nutrient Agar #3 werefrom Difco. All other reagents were of the highest puritycommercially available. Oligonucleotides were customsynthesized on a Beckman Oligo model 1000M by theDNA Core Facility of the Biology Department of Georgia State University.  A. globiformis  genomic DNAwas purified using the DNeasy midi-kit from Qiagen.Plasmids and products derived from primer extensionreaction and PCR were purified by using mini-kits fromQiagen.  E. coli   strains Novablue (Novagen) and XL1-Blue (Stratagene) were used during cloning procedures, Scheme 1. 2 Abbreviations used:  IPTG, isopropyl- b - DD -thiogalactopyranoside;PMSF, phenylmethylsulfonyl fluoride.150  F. Fan et al. / Archives of Biochemistry and Biophysics 421 (2004) 149–158  whereas strain Rosetta(DE3)pLysS (Novagen) was usedfor protein expression.  E. coli   strain Novablue cellsharboring plasmid pET/ codA 1 or pET/ codA 2, strainXL1-Blue cells harboring plasmid pET/ codA 3, andstrain Rosetta(DE3)pLysS cells harboring plasmid pET/ codA 1 or pET/ codA 3 were stored at  ) 80  C as 7%DMSO suspensions. DNA sequencing was carried outwith an Applied Biosystems Big Dye kit on an AppliedBiosystems model ABI 377 DNA sequencer by the DNACore Facility of the Biology Department of GeorgiaState University. Sub-cloning of codA into the expression vector pET20b( þ )E. coli   strain JM109 harboring plasmid pGAH/ codA was grown on Luria–Bertani agar medium containingkanamycin at a final concentration of 15 l g/ml for 16hat 37  C. Single colonies were used to inoculate 2ml of Luria–Bertani broth medium containing kanamycin(15 l g/ml) and the resulting liquid cultures were grownat 37  C for 7h. After harvesting the cells by centrifu-gation at 14,000  g   for 10min, the plasmid vector wasisolated by using a QIAquick Spin Miniprep kit (Qia-gen) following the manufacturer  s protocol. The isolatedplasmid DNA was then used for primer extensionreaction of the  codA  gene encoding for choline oxidaseby using the oligonucleotide primers Chox-for A andChox-rev containing  Nde I and  Eco RI restriction endo-nuclease sites designed to anneal to the 5 0 and 3 0 ends of the gene, respectively (Table 1). The  Nde I and  Eco RIrestriction sites introduced at the 5 0 ends of the senseand antisense primers allowed cloning of   codA  into thecorresponding sites of pET20b(+). Primer extensionreaction was performed in the presence of DMSO at afinal concentration of 2% for 1min at 95  C, followed by31 three-step cycles of 0.5min at 95  C, 1min at 55  C,and 4.5min at 68  C, with a final 5-min step at 68  C, ina total volume of 50 l l by using   15ng template DNA,2.5 U  Pfu  DNA polymerase, and the manufacturer  ssuggested protocol. The resulting amplicons were puri-fied by agarose gel electrophoresis using the QIAquickGel Extraction kit (Qiagen) following the manufac-turer  s protocol.The pET20b(+) plasmid vector was isolated from an E. coli   strain XL1-Blue grown for 16h at 37  C in 4ml of Luria–Bertani broth containing ampicillin at a finalconcentration of 50 l g/ml by using the QIAprep SpinMiniprep kit from Qiagen, following the manufacturer  sinstructions.Both the amplified  codA  and pET20b(+) vector weredigestedfor3hat37  Cwith30U Nde Iand36U Eco RIinatotalvolumeof60 l lof10mg/mlbovineserumalbumin,0.15mM sodium chloride, 6mM magnesium chloride,1mM dithiothreitol, and 6mM Tris–Cl at pH 7.9, fol-lowed by purification of the DNA by agarose gel elec-trophoresis using the QIAquick Gel Extraction kit. Toensure minimal self-ligation of the plasmid, pET20b(+)was further treated with 3 U calf intestine alkaline phos-phatase for 3h at 37  C, followed by purification of theDNA by gel electrophoresis extraction. The  codA  gene(160ng) was then ligated into the pET20b(+) (120ng)plasmid in the presence of 2% DMSO by incubation for16h at 4  C with 3U T4 DNA ligase in a total volume of 60 l l,and5 l loftheligationreactionmixturewasusedtotransform directly 100 l l of   E. coli   strain XL1-Bluecompetentcellsbyusingtheelectroporationmethod.Theresulting transformant colonies obtained by plating onLuria–Bertani agar plates containing ampicillin (or car-benicillin) at a final concentration of 50 l g/ml werescreened for the presence of   codA  by colony primer ex-tensionamplificationwith2.5Uof  Pfu DNApolymeraseinthepresenceof2%DMSOusingtheprotocoldescribedabove. Sense and antisense oligonucleotide primers de-signed to bind to the DNA regions of pET flanking theinserted gene were used in the screening (Table 1). Thecorrect construct, pET/ codA , was sequenced in both di-rections by using the oligonucleotide primers shown inTable1,and E.coli  strainRosetta(DE3)pLysScompetentcells were then transformed with plasmid pET/ codA 3following the procedures described above. Cloning of codA from A. globiformis genome into theexpression vector pET20b( þ )Arthrobacter globiformis  strain ATCC 8010 wasgrown on Difco #3 Nutrient Agar medium for 48h at26  C.Single colonies wereusedtoinoculateeight5mlof  Table 1Oligonucleotide primers used for primer extension amplification and PCR of codAPrimer Nucleotide sequence PurposeChox-for A CGGCAAGGAGAACCATATGCACATCGACAACATCTG CloningChox-rev CCCCGGAATTCGCCGCTCCCGCTTAGG CloningPET-for A CACTATAGGGAGACCACAACG SequencingPET-rev A GCTTATGCTAGTTATTGCTCAGC SequencingChoxag 3 CAATGAAGTCGTGCTCTCC SequencingChoxag 5 CGAAGTTCAACACC SequencingChoxag 7 CGATGCAGGAGTTGTGG SequencingEndonuclease restriction sites for  Nde I and  Eco RI enzymes are underlined. F. Fan et al. / Archives of Biochemistry and Biophysics 421 (2004) 149–158  151  Difco#3 Nutrient Brothandthe resulting liquid cultureswere grown overnight at 26  C. The cells were harvestedby centrifugation at 14,000  g   for 10min and the genomicDNA was isolated using the DNeasy Midi-kit (Qiagen)according to manufacturer  s instructions. The isolatedgenomic DNA was then used for PCR of the  codA  genewith the oligonucleotide primers described above. PCRwas carried out with an Eppendorf Mastercycler in thepresence of 4% DMSO for 1min at 95  C, followed by 31cycles of 1min at 95  C, 1min at 50  C, 2min at 72  C,and a final 5-min step at 72  C in a total volume of 50 l lby using   200ng of template DNA, 5 U  Taq  DNApolymerase, 3mM magnesium chloride, and the poly-merase manufacturer  s suggested protocol. The resultingamplicons were purified by agarose gel electrophoresisusing the QIAquick Gel Extraction kit (Qiagen) follow-ing the manufacturer  s protocol.Endonuclease digestion of both the amplified  codA and pET20b(+) with  Nde I and  Eco RI, dephosphoryla-tion of the plasmid with calf intestine alkaline phos-phatase, and ligation were carried out as describedabove, and 1 l l of the ligation reaction mixture was useddirectly to transform by electroporation 100 l l of   E. coli  strain Novablue competent cells. The resulting trans-formant colonies obtained by plating on Luria–Bertaniagarplatescontaining 50 l g/ml ampicillin and12.5 l g/mltetracycline were screened for the presence of   codA  bycolony PCR. PCR was performed with 5U  Taq  DNApolymerase in the presence of 2% DMSO for 1min at95  C followed by 31 three-step cycles of 1min at 95  C,2min at 55  C, 2min at 72  C, and a 5-min final step at72  C, using sense and antisense oligonucleotide primersdesigned to bind to DNA regions of pET20b(+) flankingthe inserted gene. The correct constructs, pET/ codA 1and pET/ codA 2, were sequenced in both directions asdescribed above.  E. coli   strain Rosetta(DE3)pLysScompetent cells were transformed with plasmid pET/ codA 1 for protein expression. Expression of choline oxidase in E. coli  Permanent frozen stocks of   E. coli   cells Ro-setta(DE3)pLysS harboring plasmid pET/ codA 1 wereused to inoculate 50ml of Luria–Bertani broth mediumcontaining ampicillin (or carbenicillin) and chloram-phenicol at final concentrations of 50 and 34 l g/ml, re-spectively, at 37  C. After 9h, 1ml of the starter culturewas used to inoculate 3  1.5 liters of the same liquidculture medium at 30  C. When the culture reached anoptical density at 600nm between 0.8 and 1.4, typicallyafter 16h, IPTG was added to a final concentration of 50 l M and the temperature of the culture was loweredbetween 21 and 25  C. Cells were harvested by centri-fugation at 20,000  g   for 20min at 4  C and stored at ) 20  C. Typically,   8g of wet cell paste was obtainedfrom 1.5 liters of cell culture. Purification of recombinant choline oxidase Unless otherwise stated, all the purification steps werecarried out at 4  C. The cell paste, typically 25g, wassuspended in 6 volumes of a solution of 0.1mM PMSF,0.2mg/ml lysozyme, 1mM EDTA, and 50mM potas-sium phosphate at pH 7 and allowed to incubate withstirring for 30min on ice. The resulting slurry was pas-sed three times through an SLM Aminco French pres-sure cell at 20,000lb/in. 2 and then centrifuged at 20,000  g  for 20min. The supernatant was collected, incubatedwith stirring for 30min on ice with 20 l g/ml RNase and50 l g/ml DNase in the presence of 10mM magnesiumchloride, and centrifuged as described above. The solu-ble fraction was brought to 30% ammonium sulfatesaturation, incubated for 30min on ice, and separatedfrom the insoluble fraction by centrifugation as de-scribed above. Choline oxidase was then collected in thepellet fraction by treatment with ammonium sulfate at afinal saturation of 65%, followed by centrifugation asdescribed above. The resulting pellet was suspended in25ml of 200mM Tris–Cl, pH 8, and dialyzed againstthree 1-liter changes of the same buffer over 20h. Afterdialysis, precipitated proteins were removed by centri-fugation at 18,700  g   for 20min and the resulting super-natant was loaded onto a DEAE-Sepharose Fast Flowcolumn (3  28cm) connected to an   AAkta  prime  Amer-sham–Pharmacia Biotech system equilibrated with200mM Tris–Cl at pH 8. The column was eluted with 2volumes of the same buffer, followed by a linear gradientfrom 0 to 0.5M NaCl developed over 5 volumes at aflow rate of 2ml/min. The fractions with the highestpurity as judged by enzymatic activity and UV–visibleabsorbance spectroscopy were pooled together andconcentrated with the addition of 65% ammonium sul-fate saturation followed by centrifugation. The resultingpellet was resuspended in 10ml of 200mM Tris–Cl, pH8, and dialyzed against three 250-ml changes of the samebuffer over 20h. After removal of the precipitated pro-tein by centrifugation, the enzyme stored at ) 20  C wasstable for at least six months. Enzyme assays The concentration of choline oxidase was determinedwith the method of Bradford [35], by using the Bio-Radprotein assay kit with bovine serum albumin as thestandard. The oxidized flavin content per enzyme activesite was determined as described in [36]. Enzyme activitywas measured with the method of the initial rates [37] inair-saturated 50mM potassium phosphate at pH 7 bymonitoring the rate of oxygen consumption with acomputer-interfaced Oxy-32 oxygen-monitoring system(Hansatech Instrument) thermostated at 25  C. The re-actions were started by the addition of choline oxidaseto a 1ml reaction mixture, with the final concentration 152  F. Fan et al. / Archives of Biochemistry and Biophysics 421 (2004) 149–158  of enzyme in the 0.1–0.5 l M range; the concentration of choline or betaine aldehyde was between 0.02 and10mM. UV–visible absorbance spectra were recordedusing an Agilent Technologies diode-array spectropho-tometer Model HP 8453 equipped with a thermostatedwater bath. Fluorescence emission spectra were re-corded with a Shimadzu Spectrofluorometer Model RF-5301 PC thermostated at 15  C. Methods The molecular mass of the enzyme was determinedby MALDI-TOF mass spectrometry on a MicromassTofSpec 2E at the Mass Spectrometry Laboratory of the Georgia Institute of Technology, Atlanta. Sam-ples were prepared for MALDI-TOF analysis by gelfiltration using a Sephadex G-25 column (PD-10,Amersham–Pharmacia Biotech) equilibrated with5mM Tris–Cl, pH 8. MALDI-TOF spectra were ac-quired in the positive ion mode using sinapinic acidas the matrix, with an acceleration voltage of   ) 20kVand a pulse voltage of   ) 16kV. Cytochrome  c [12,400], myoglobin [17,000], trypsinogen [24,000], andbovine serum albumin [66,000] were used as stan-dards for mass calibration. The molecular weight of the enzyme under non-denaturing conditions wasdetermined by size exclusion chromatography througha Sephacryl S-400 column (1  50cm) connected toan   AAkta  prime  Amersham–Pharmacia Biotech systemequilibrated with 300mM KCl in 20mM potassiumphosphate, pH 7, at a flow rate of 0.5ml/min. Thefollowing proteins were used as standards: horseheart cytochrome  c  [12,400], bovine serum albumin[66,000], yeast alcohol dehydrogenase [150,000], sweetpotato  b -amylase [200,000], and horse spleen apofer-ritin [443,000]. SDS–PAGE according to the methodof Laemmli [38] and PAGE under non-denaturingconditions were performed in 12% polyacrylamideslab gels, with visualization of the proteins by stain-ing with Coomassie brilliant blue G-250.For denaturation experiments, choline oxidase wasincubated at 40  C for 1h in the presence of urea at afinal concentration of 4M in 100mM Tris–Cl, pH 8,before recording the UV–visible absorbance spectrum.The flavin content per monomer of enzyme was calcu-lated from the ratio of the concentration of flavin in thedenatured enzyme using a  e 450nm  value of 11.3mM  1 cm  1 [39] to the concentration of proteindetermined using the Bradford assay [35]. To establishwhether the flavin is covalently bound to recombinantcholine oxidase, the enzyme was incubated with tri-chloroacetic acid at a final concentration of 10% for5min at 100  C, followed by removal of denaturedprotein by centrifugation at 14,000  g   for 10min beforemeasuring the UV–visible absorbance spectrum of theresulting supernatant. Data analysis Kinetic data were fit with the KaleidaGraph software(Adalbeck Software, Reading, PA). Apparent kineticparameters in atmospheric oxygen were determined byfitting initial reaction rates at different substrate con-centrations to the Michaelis–Menten equation (Eq. (1)),where  K  a  represents the Michaelis constant for choline(or betaine aldehyde) (  A ) and  k  cat  is the turnover numberof the enzyme ( e ). ve ¼  k  cat   A K  a þ  A :  ð 1 Þ Results Cloning of codA The  codA  gene from  A. globiformis  encoding forcholine oxidase was previously cloned in the binaryvector plasmid pGAH for in vivo experiments aimed atconferring tolerance to salt stress in cyanobacteria andplants [10,11,25–28,40,41]. In this study,  codA  wasamplified from pGAH/ codA  by primer extension reac-tion by using  Pfu  DNA polymerase in the presence of 2% DMSO. Addition of DMSO was required to ensurecomplete denaturation of the highly GC rich DNAtemplate in the primer extension reaction. Directionalcloning of   codA  into pET20b(+) to construct plasmidpET/ codA 3 was achieved by inserting  Nde I and  Eco RIendonuclease restriction sites at the 5 0 and 3 0 terminalends of the gene, respectively. Plasmid pET/ codA 3 wasthen used to transform  E. coli   competent cells strainXL1-Blue. Successful construction of plasmid pET/ codA 3 was confirmed by nucleotide sequence analysis.However, seven differences were found in the nucleo-tide sequence of   codA  with respect to the sequence of the gene deposited in GenBank (Accession No.X84895). Of the observed discrepancies, three ac-counted for missing nucleotides at positions 891, 1117,and 1232, resulting in a translated sequence of 113amino acid residues in the central portion of the pro-tein being different from the published sequence(GenBank Accession No. S52489). Surprisingly, nointernal stop codons were created by the three single-point deletions, resulting in a translated protein of 546amino acid residues. Two other differences were ob-served at positions 764 and 1496, which resulted in thesubstitution of an arginine with a histidine residue andof a glycine with an alanine residue, respectively. Fi-nally, two silent nucleotide substitutions that resultedin no change at the amino acid level were observed atpositions 832 and 846. The nucleotide sequence of   codA was found to contain the same seven discrepancies whenthe gene was sequenced directly from pGAH/ codA , F. Fan et al. / Archives of Biochemistry and Biophysics 421 (2004) 149–158  153
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x